Locus Mono:snR3
snOPY snoRNA Orthological Gene Database
Mono:snR3
Mono:snR3
II
snR3
1001..1168
2167
ATCCTCCTTCTCAGGCTTCTCCGCAACCGACTCATCTACAGAATTTTTAACGACATTTT
CAGATGTTTCCGGAGACTGAGTAGAAGCATCGCCGGTGGATGCCTCAGCACCTTCAGCTG
AAACTACATTCGAAGCAGAAATATCCTCAGTGTTTTCAACTACTTGAGTATTGTCATTGC
CTGTAGGCTCATTTACTTGATTATTGCCATCATTAGATTCGCGGTCAACATTATCTTCGG
CAACTGAATTTTTAGATTTAGCTTGGCGTTTTTTCTTCTTGACCTCCAGCAACTAGCACT
CGTAAGTTAAATGTTACAAAATATTATGCATACCCTTTGTTTAGCTGCAGCTAGCTTTTC
TTCACGATCTGACATCTTCAAATTTGATACAAGATGAAAATAAATCAACAGGGAGTTGTA
GTGTGGGCAGAATCAGTAAAGTATAGGTAAGTAGGGAAAGTTTGCGTGAGGCTTAACAAG
TCCACGGATAACCAAGCATACTAAATAAAGTAGAAACATAAATATAATATATATTTGATG
AATGAAAAACTTAAAAAAATGGATTCATATTTTTTATACGCTAGAGAGTATAGGTATATT
TTATTACGCTGATTCGGTTTGAAAATGAAGGAAGATACTCTCCAAAGTTAATGCAAGAGC
AGAATCCTTTCATTAGTTTTTAAAGATTACTATGTGTATGATAATATTACTGTTTAAAGA
GCAAAAGAAAGTAAATACAACCTTTGTTTTCAAGATCGATTCCGTGAATAATAAAAATCA
ACGTTGGCAACGCTTACAGTTCTTTACAACTTCAAACGGATTAAATAATCCGGTTTATTA
AAAGACTCAACTAGCTTTGACTATGCCTATACTAATGAGTTTTTAATCGATCAATATATT
ATTGTGACTTAGTTCATCTAGCGACTGCTTTTTTTCATAGTCACTATTGAAGTAACAGTA
TTTTTTTGCTATATAAAGTGGTATTATGGTCACTTTACATTACCGTACTCGCTCAAGACA
GTGCGAATAGGAAGGTTTTTTACCCGCATGGTATTTTGCTATGCATTCGTATTTGCTATT
CACTGAGCGTATATAAATGAATGGATCTTTTAAGAGCTTGCTAACAAGATAACCTACTTG
TACGCGAGTGTCAGAAGGTCCACATATTTGCTATAGATTAAAATTTATTATTACATTTAA
AACAGATTCGTTAACAAAGAACCTTTTGAAATTACTTGAGTTAATGGTTTATTCTTTTCG
CGAAATTCTATATCGCTGTAATTTGTGTGATCGTAGACTTCCTATTTGTGTTGGATGCGT
ACTAAAGTTTGCTTGGAATCCTGTTAATACATGTTTTTAAAAACCACTGAAAGTGTATAG
CAATGCTTGTAGAGCGTATATCCAAGATTTAAATAATATGCTATGTAATTCTGTGCGATG
GGTAATATAGTTAATTATTTAAATAGCTATAAAATATAGAACGACTACTGTTTAGGTTTG
TCCATGCTACATCTTGGAAGAAAATAGAAATATAGTATTCTTGTTGGCTAATGCAATAAA
TCTTCAAGTTTATATAGCAAATTGTGAAGTCAGTATTCGTAAATTTGACAAAAATTTAAT
GATAATTTATTTTTTCAGATTTGCTGACTTTAAGTAGTCGGTATCTGCTTTTTATGCATA
AACAAGAAGATTCAGTTCGAGGATCAGAATCCTTTTTTGTATCATCAAACTTGAAATTGT
CTTATAACATCATTAAAGCCAACCGAGTGTACCAAGCATGCGATAATGTAAGTTTTAAGA
ATCATTCAAAAGTATATTTTTCAAAGCTTGAGCAACGACAGAAATAACCTGTAAAATTCT
AATGAATCAATGGGCTGTGCAATCAATTTATAATCAGTTGAGATTTGTTGCTCTGAGAAT
AGTAATACTTACACGCCTTTACAAATAAGCGTGTTTTAGTCATTAAGTTAGAGCACTATC
GTTGTTCGAATACAATAACAATTATTTAAAAAAGCGATGTGATGAGGAAAACAACAAAAA
GCGTAGTACTGTCATTCAAATCAAAGTAATGTAAAAATAATGAACAATTTTAAACAATGA
TGATAGCTTCGATACTTGTCTCACAGCTCATATAAATCTTCGTTGACACCTTTTTCTATA
CTATGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved