Locus spt20
snOPY snoRNA Orthological Gene Database
spt20
spt20
I
snoR69
3189..3236
4475
ATCACGGGAATCCTCTGTTATGAGATCAGATGGTTCCTCGTCTCCGTCAACATTGGAAA
GGCCCGACTGGGAAGCTTGAATATGAGATGCTTGAGTTGGGCGTTTGTTTGAAGCAATTA
GAATAAGCGCCATGAATATTTGTAGACAGAAAAGTACAAGATCGGACGTTATAAAATCTA
TACGTGAAGATTCATTTTTTTCTCCAATGAAATTGATAATAGAGCCACCATACAAATATC
CATCCAAGCTTTCTCCTGCAGTAGGCAAATTAAAGAACATACGCACCATTAAAGATATTA
GAAAATTAAGCAGAAGCGGATAAAAAAGCGGTAGAGCGTTTAACTGAGAGAAAGGTTTGG
GGGTAAGGTAGCTCTAGCAATTTATGTTAATACATGACTAGAAAAAAGCAAAATCATGAA
CATAGCATCTCTGGCTTTTGTATAATGAAAAATAAACTAAATACTGGAACAACTTACCAA
TTGAACAAAAACCTTGAGTAACAGCAAGAGAACTGTAGGGCTGACAAGAATTAGATTAGT
GATTTCTACTATAGAATCCAGAAATTTTGCTTACTCTTGAAAATATTGTTGAGCTATAAT
TGCATAACACAGCATATCTAGCGATCGAAAAAAGCTGAACACTTCTCCCCGCTGATCTAA
GACAATAGTGTCCATGCCTAATTTGTAGAAAAGTAACACAAAACAAGAATACTTTTGAGA
GTATCAGAAATTACAGCTTTAAACAAAATCAATGAAAACTTTGTCAATTTCAAATATTTA
GATATTAATTTGAGTCAAAAGTAAACGCAGAATGAATCATGCCAACAAGAACTTGCTGCG
GTGGAGGAAAACGATAATGCCAGAACTGCTCAAGCTAGAGGCTATTTTGGATTAGGGCTT
TGAAGCGCGTAAACTGCAAAACTATTAACGAAATCTTGAACTTCGATACCATTAATAACG
CATCATTACATTTCGTTATGTGAGCAAACGCTTCTATCTATCTAACCTAGTAGGATTTGA
AGAATTTAACCAGCTTATAATTTTAATTGTAAACATAGGGGGAATATTGTTTTACAATTA
CTGGTATAGTTCGTTGAACTAAGAGATGGAAAGAAATAATGGTTTGGGCGACTATACGTA
TCGCTATCATGGGAAGGAATTGAGTTTGGACGATTTTCAGAATAAACAAGGAATTGAATC
CTCAGATGATGCATTTTTATCAAAAATTTATGAAAACGTTTCGAATTTTAATGGTAAGTA
GTGTTGAGGAAGTTTTGCTTCTTTGGTTTTTTTGCGTATTTGATTTTATCGACTCTAACT
GACATAATACTCAAGTTCCCAGAAAATTGCATGATATTGAACATAAATTTTCGAAAGAAG
AGCCGAGTTTAATTCTTCATATTCATAAATTTCATTTTCGGTTTGAGCAACAAGATGGCG
CCTTCACCTATAATGGGCCGGTAAAATCAATTTTGCAATATATAAGGATGGAGCTTATAC
CACCTGATTGTCTTGAAGTATTTCGGAATTCCGATGTAAAATTCTATGATGGTTGCTTAA
CGGTTCGTATAATAGATCATCGGCAAAGTCCTTCTGCTGATCAGACTGTGCAACCTCAGC
CTGGCTCTACTAATCAACAGCAGCAAAATAACACCAACCCAATTAATAATCAACCTGAAG
ATACCAAACCCAATACTAATTCACCTCCAGTGTATCATACAGTTCTTCGTCCTACTCCCG
AAACACTTTGGCAAGATTTATGTTTACTTTCAGAAAGCTTTGCTAACTCACTTTCGGATG
AAGCTGTTTTGACTTTGGAATCCAACATTCTACTAGCGTCAGAAGCTCCACTTTTCTTAA
CTCCTGCGAAGTCTAAAGCGGAAATGATTCAATTTATGAACCAGTTGGCCGACTCTGCAC
CACCATGCACCAGAAAGAAACCTCAAGGATCAGCCCAACTTGCTGATGAAGAAGCAGAAA
GACTTGAAAAAGAGAACCTTTTGTTACTAATGGATGACCAAAGAAAACGCGATTTTCAAC
CTACCTTTCAAAGACTACAATTTATTGAGAATGTGCGGCGTAAACGAGCTATTCTACAAC
AAAGGCAAATGCAAATGCAACAGCAACAAAAAGCGCAGCAGCAGCAATCACCGAAAGCTC
AGCAACCACCCGCACATTTGGTTCAGTCTGCTCCAGTTCAAAGAAAAACTACACCCAAAA
TCCAACGTCTACCACCTAGTAGTATTCAAATTCCCCCTCCGAAACCTATGCAGAAATTCC
CAGCTAATGCGGCATCTTCTGAATCGCCCCCCAATGCGACTGGTAAGTGTATTAAAGGCT
TATTTCAGTACTTTTTGAGTTCAATTCAATTTTATTTTAATTTTGTATTTATTTTTCTAA
CAGCTTTAGGAAACTTTTTACCTTCGGGTCCTGTACCTGCAAATGAACCTATGTTAAAAC
GAGAATCCGTGGATTTGATAAAAATACGACAACTTGCAATTTTGTTTCAACAGCGTGCCT
CTCAATTAAAAGCTAGAGGTGCTACACGGGAACAAATTACTGAAATTCTGAATCGTCAAG
CAATAGCCGCTGGTACTGATTTGGCAACAGTAATGACGGTTGCACGAAATCTTCATTTTC
AACAACTCCAAATGAGACAGCAGCAACAACAGCAGCAAATGAAGGCTGAAAGGTAACTCT
CAAATGCTTCATCATTTAATACACGAATTTAGTTTTTTATTTATTATTTTTAAAATTTTA
TTTTTTTTGTTGCATAAATACGTTTTTTTACTTCACTTCATTTTCCTCTATAAAAACTTT
TTTGCTCATGGAACAACTTGGCGTTTTCACTTACCAGTGTGAGATATGTAATGTAGCTGT
TTCTAATAACACCCAGTTTTAGGTAAGTAAAATTAATATGTTATTTGGATATTTTTGTAT
GATGACTATAATTTGCGATTGAGCGATGGTATTGCTCGGGATCTTGCCTGATTCCCATAT
GGGCTCCATCAGTATGCGACAAATAATCTTCTGATTGATTTCCATTACATCAACTGCTTT
TGTTAATACGAATACCTTGCTAACTGTTTTAAGTTTTAAATATTATAATAATGGAGTTAA
AGAACGTCCTGTTTTTTATGAACGTTAGGTAAGGCAATTTAATTTTCAAAACAAATAACC
GTTCTGCTTTGCAATTGATGAAATATTTGCTTATGATCAATAAATGATTCTTTTATTATC
ACCAAGATCGCTGAGTGCTAAAGTTTTTGGTTATTTTATTTGTTTTAAATATTTTCGAGT
TATTACTAACCCATAGCGATATGAACTTTTTTAGATGTATATGTGTATAACCTTGTATAT
ATGTATAACTTTTTTGCATATATATGTACATGCGTTTTCATCTGTAATTTATTCCCCTTC
GCTTTTAGCTAATATTGATCTATGAGTATATATTTTTAATCTAAAAATTCCTGACTAATA
TCACCTTTACCTTGATTAGTTTAGACACACTTTGTAGAGTAAGTGCACGAAATTTTTATT
ATATCTATTTCAAAAAAAAGGTTGGCTGACAACGGTTTGATACACAGTATTAGTCCATGT
CCGTCTCAATTTTTTCCATATCAACCAGCCGCTCACCCCGAGCGATACGGCCAGCTTCAA
CGCGATGATCAACGCCAATTTCGCATTCACGAAGTTTTGACTTAGCGCCTATTTGAGCAC
CTGAGGCGACTATGCAAGATTCTAAACGTACTCCGTCTTCAACAACAATGTTGTCCATCA
AAATAGAGTTGCTGACCACTACCCCTTTTCCAATTACACAATTTTTACCGATAATGCTCT
TTTTAATGTTGCTGTTATCCTTAATGGTGGTACCTTCATTCACCATACAATCGGCACCGA
CCAGTGCTCTTTCGGACACGGTGACATCTACAAGGCGTTGTTCTGGAGTAAGTTTGGCGA
TCTAGTTTGCTGTTAGAGATATTGGATGAAACTGCTAAAAAGCGAGATGAAGCTCAGCTT
TCGAAAACATACGCATTTATTAAGTTCGAAATAGTTAGGTAAATTATTAGCCCTAGAACA
AATAATCCCATCTTTGGCAATTAAAGCATTAATTTTAATTTCCTGTGAGGATAATCCCCC
ATCATAATTATCAATATTGTTAGGAGATGACAAAACTTTAATTGTTAGAAAATAGTTAAT
TAAAAAAAGCACTTACATCTTTGAATGTTCTCTCGTACAGTAAAGGATTTCTGATATTGA
CATTTAACAAGATACGGGATGAGATCTCCACGAATGCTAGAAATAGATTCTTTCTCCCGG
ATCAAATCAATAACCCAGTGTTTAAATACAAATATATGGGCATCCGAAAGGTTTGTATTT
AACGTAACCCTTGGGTGTTTCCACAACAAAGACATTCTAAATGTAAAATCACTGCCCACG
TCTGCGGAACTTTTGGCATACAATAGTCTGCTCGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1252, 1335..2321, 2409..2901, 3093..3147, 3316..3475
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved