Locus Mono:SNORD24
snOPY snoRNA Orthological Gene Database
Mono:SNORD24
Mono:SNORD24
I
SNORD24
1001..1071
2070
GCTCCAGTTCAAAGAAAAACTACACCCAAAATCCAACGTCTACCACCTAGTAGTATTCA
AATTCCCCCTCCGAAACCTATGCAGAAATTCCCAGCTAATGCGGCATCTTCTGAATCGCC
CCCCAATGCGACTGGTAAGTGTATTAAAGGCTTATTTCAGTACTTTTTGAGTTCAATTCA
ATTTTATTTTAATTTTGTATTTATTTTTCTAACAGCTTTAGGAAACTTTTTACCTTCGGG
TCCTGTACCTGCAAATGAACCTATGTTAAAACGAGAATCCGTGGATTTGATAAAAATACG
ACAACTTGCAATTTTGTTTCAACAGCGTGCCTCTCAATTAAAAGCTAGAGGTGCTACACG
GGAACAAATTACTGAAATTCTGAATCGTCAAGCAATAGCCGCTGGTACTGATTTGGCAAC
AGTAATGACGGTTGCACGAAATCTTCATTTTCAACAACTCCAAATGAGACAGCAGCAACA
ACAGCAGCAAATGAAGGCTGAAAGGTAACTCTCAAATGCTTCATCATTTAATACACGAAT
TTAGTTTTTTATTTATTATTTTTAAAATTTTATTTTTTTTGTTGCATAAATACGTTTTTT
TACTTCACTTCATTTTCCTCTATAAAAACTTTTTTGCTCATGGAACAACTTGGCGTTTTC
ACTTACCAGTGTGAGATATGTAATGTAGCTGTTTCTAATAACACCCAGTTTTAGGTAAGT
AAAATTAATATGTTATTTGGATATTTTTGTATGATGACTATAATTTGCGATTGAGCGATG
GTATTGCTCGGGATCTTGCCTGATTCCCATATGGGCTCCATCAGTATGCGACAAATAATC
TTCTGATTGATTTCCATTACATCAACTGCTTTTGTTAATACGAATACCTTGCTAACTGTT
TTAAGTTTTAAATATTATAATAATGGAGTTAAAGAACGTCCTGTTTTTTATGAACGTTAG
GTAAGGCAATTTAATTTTCAAAACAAATAACCGTTCTGCTTTGCAATTGATGAAATATTT
GCTTATGATCAATAAATGATTCTTTTATTATCACCAAGATCGCTGAGTGCTAAAGTTTTT
GGTTATTTTATTTGTTTTAAATATTTTCGAGTTATTACTAACCCATAGCGATATGAACTT
TTTTAGATGTATATGTGTATAACCTTGTATATATGTATAACTTTTTTGCATATATATGTA
CATGCGTTTTCATCTGTAATTTATTCCCCTTCGCTTTTAGCTAATATTGATCTATGAGTA
TATATTTTTAATCTAAAAATTCCTGACTAATATCACCTTTACCTTGATTAGTTTAGACAC
ACTTTGTAGAGTAAGTGCACGAAATTTTTATTATATCTATTTCAAAAAAAAGGTTGGCTG
ACAACGGTTTGATACACAGTATTAGTCCATGTCCGTCTCAATTTTTTCCATATCAACCAG
CCGCTCACCCCGAGCGATACGGCCAGCTTCAACGCGATGATCAACGCCAATTTCGCATTC
ACGAAGTTTTGACTTAGCGCCTATTTGAGCACCTGAGGCGACTATGCAAGATTCTAAACG
TACTCCGTCTTCAACAACAATGTTGTCCATCAAAATAGAGTTGCTGACCACTACCCCTTT
TCCAATTACACAATTTTTACCGATAATGCTCTTTTTAATGTTGCTGTTATCCTTAATGGT
GGTACCTTCATTCACCATACAATCGGCACCGACCAGTGCTCTTTCGGACACGGTGACATC
TACAAGGCGTTGTTCTGGAGTAAGTTTGGCGATCTAGTTTGCTGTTAGAGATATTGGATG
AAACTGCTAAAAAGCGAGATGAAGCTCAGCTTTCGAAAACATACGCATTTATTAAGTTCG
AAATAGTTAGGTAAATTATTAGCCCTAGAACAAATAATCCCATCTTTGGCAATTAAAGCA
TTAATTTTAATTTCCTGTGAGGATAATCCCCCATCATAATTATCAATATTGTTAGGAGAT
GACAAAACTTTAATTGTTAGAAAATAGTTAATTAAAAAAAGCACTTACATCTTTGAATGT
TCTCTCGTACAGTAAAGGATTTCTGATATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved