Locus ade4
snOPY snoRNA Orthological Gene Database
ade4
ade4
I
snoR58
1243..1318
4552
GTTGTTCTTCAAGGCGTTGGATGCTTTTACAAAAGGTTTTTACCTAAAAGGATGCTTTG
AAGCCAAAATCTTTTATAACCTGATAGAAGACGAATTATTGGGTTTTTTTGCAGTACGCC
AATATTTGATGAAGATGGAAAACCTTACTTTCCTAGATCCCTACTAACGAGCCAAAAGTT
TACACGTTACACATCACTATCTGAAATAAAAATGTGCTGAATTTATATTTGTGTTTAGAA
AAATGTATTCATGAAATATGAACTATTGATGATTTTTTTTTAAAATGATTTACCAACTCA
AAATGTGGAGCTGCTTGAAAACTAATTATTGCTTTGCACTTGTAATTTTGTTTAATGTGC
AATATTAAAAAAGATGTTTTAATAATCAACGATTTATAAATCGGTACGTTTTCGCGATCC
TGGTTTATAATCAATCCGATAGTAAAAAATATCAATCAAGCGCTCAGAAAATGATCCTCT
GTACACCAATTAAGGAACAAATATTTGAAGCCGGTTAGTAAACTATTATTTTGAGGAATC
AGAAGATTAGAGATACAGTACATTGTGTATTGTTTTCATTAGTTTTTTAAGTTTAAAAAC
CATTGGACTACTGCAATCGTAACAAGTTGAACTAAAAGTTTTGGATTAGATTACCCATAG
CTCTCATCTCGGTGATTAATGTATTGTTGTTAACTACCGAGTAAAGAAGGAAGAAAAACC
AGAACATTGAAAGATTTTATAACAAATAAATAGTAATGGGATACCTCCGGTAAAGCTCAA
TAATAAGTTGATGTGTATGCGGCATTACTGTAACACTGCACCACTCTTAACTTCATCGAA
TTTTTTTTGATATAAGAAGGTTTTATTTAAAGATATATTTTTAAGCTTAAAAAATTTTTT
TTGGCAACAAAAATAGCAAACAATTTAATATCATCTACCCTGTCAGCTAAGTAGCAAGCT
ATACCTGTTACCTATATTAACGTGCGCATATCCCACCTCTCTTTAAGCTTCTATTTAGCG
AATCGTTCATCACAATCTTGAGCAGTCATAGTTTCGACTCATACTTCACTATCATTTAAG
GCGGACAATAAATTAATTTATACGGCAGCAAAATTTTGCCTTAACAATATACCCAACTAC
GGTGTTTGTTCAGCGCGTACCTGAAAATCTTTTTTTTTTTGTTTCGTACGCGTTTTAAAA
AGTAAGTTAATATAGATATTGATTTTCCAACGCCGCAGTACTTGCCTATGATGATTACCG
TTTATTTAGATGCTAGACTTCTGAATTTCATCTTATGTAGCTACAAGGTTTTCTGAGGTC
TGCTTAATTGATTAAAATTTTTTATTTTCTGTGATGGTAACATACAACTCATTTTACGGT
CGGTACAAAAAAATTGAAATTATATTCCAAGTATTCTCAAACTTTGATTGCTGTCCGAAT
AGAACAGTCCGACTCATATTATTTTAATCAAGTTATAGCAATTTGACTGGGTGCTGTTTT
TTCTTTTGTACATTTAAACCTATCATTTTATTATCTTTTGTATTCAATTCACAACCGAAG
CTCTAACAAGTTTTAGAAAATGTGCGGAATTTTGGCGTTAATGCTTGCTGACCCTCATCA
ACAGGCATGTCCTGAAATTTATGAGGGTCTTTACAGTTTGCAGCATCGGGGTCAAGATGC
CGCCGGTATTGTAACCGCTGGAAACAAAGGTCGTCTTTACCAATGCAAGGGATCCGGCAT
GGTTGCCGATGTTTTTAGTCAGCATCAACTTCGCCAACTCGTAGGTAGTATGGGTATTGG
TCATTTGCGCTATCCTACTGCTGGAAGTTGTGCTCACTCTGAAGCACAACCCTTTTATGT
TAACTCTCCTTATGGTCTTGTGTTGGGCCATAATGGTAATTTAATTAATGGACCCGAATT
ACGACGCTTTTTGGACACTGAGGCCCATCGTCATGTAAACACTGGATCTGATTCTGAGCT
TTTGCTTAACATCTTTGCTTACGAGCTTCAACGGTTGGATAAATTTCGTATAAACGAAAA
TGATATTTTCGAAGCTTTGCGTAATGTATACGATCGCGTTAATGGTGGTTATGCATGTGT
TGCTATGATCGCAGGCTTGGGTGTTTTGGGATTCCGTGATCCCAATGGCATTCGTCCTTT
AGTGATCGGTGAACGTGATACCCCCGAAGGAAAGGATTACATGCTTGCTAGTGAGAGTGT
TGTATTGACTCAATTTGGATACCGTACATTCAGAGATATTCGCCCCGGTGAGTGTGTCTT
TATTCGTCGTTCCAATAGGGAAGATATACTTGCAGGGTTTAGAGGCCCTCGCTTGTTTTC
TCGTCAAATCCTTCCCTGCCTAAGATTTACTCCCGATATATTTGAGTATGTCTATTTCGC
TCGTCCCGACTCTGTTATTGACGGATTGTCCGTATACCAATCCCGTTTAAATATGGGTGA
AAAGTTAGCGCATACTATAATGAAACGGTTTGGTCCCGATTACATGGAAAAAATTGATGC
TGTCATTCCTGTTCCAGATTCTGCTCGAACCAGTGCCCTTGCACTTGCACAGACAGCTCA
ACTGCCATACGTCGAAGCTTTTATTAAAAACCGATATATTGGTCGTACCTTCATTATGCC
AGGTCAACAGATTCGTCGTAAATCGGTTCGTCGTAAATTAAATGTTCAACCTCAAGAGTT
TTTTGATAAGAATGTTTTAATTGTGGATGACAGTATTGTTCGTGGTACCACCTCTCGTGA
GATCGTTCAAATGGCTAGGGAGTCGGGTGCAAAGAATGTCTATTTGGCTAGTTGCGCTCC
TATGATCACTCATCCTCATGTCTACGGTATTGATCTCGCTGATTGTAAGGATCTCATTGC
TTATGGAAAAACTGAGGATGAGGTTGCTGAAGCAATTAGTGCCGATGGTGTCATTTATCA
AACATTAGAAGATTTATTAGATTCTTGTCGTACGGCTGAGCTGACCGAATTTGAAGTTGG
TCTCTTTACTGGCGAATACACTACTGGCGCTAGTAAAGAATATTTAGTCCATCTTGAGCA
AATGCGTATTGCTAACAATCGTGCTCGTAAGCATAGCTTTGCAGAAGATGAGGAACGTGA
AGCTCCCGAAGACATTTCTCTCCATAACACACATTCAGATGTTACTTTTGATTTTGTTTA
ATTCCCCAATTTATTCAATGCTTAGTGCTTTATTATAATAACCAATCCTCCATTTACTTT
GTCTAGATTGATGCTCTAATCCATTGTTGAATACTAATAGAATGTACAATCGCCCCATCA
ATGGTTTTTTGGTTGATTTTAATTTCTGAATTTTTGTCCTCTTGAAACTTTTCTTGAAAT
TAAAGATAATTTCATCAGCTCCTTGTTGTTAATTTTACTTTTTGTTACCAATTAATATAT
ATTGTTTCAATATATAAGTTTACCCATACTCTTTAAGACTATTAGATTATAAGTAGTGTC
TGAAAAAAATTTTCTACACACTTTTATAAACATGCAATAATATACAATATTGGTTTTTTT
TTTTTGGTCTCTTAACCTTTTCATAAAATGAAACATAATTCAAAGTCTGTTTGTACTATT
TGCATAATTATGTTACAAACTCTTTCGACGTTTTTACTTGTATAGTCCACCAACTTCTTC
ATTTCTTTATATAAATGCGTATAACGGTAAAAGCATTCTTTCGTTTAATCAATAACTAAA
AACCTATTAATTTAAGTCTATGTTTCAATACAACTCACTGTTTTGGCGAAACTCGTGTTG
AATGATTCCGAAGAGAGGGGATTTCGATATCATCAGTGCCTTTTGTGATGATGTCTAGAA
AGCGACAGGCATCCTCTAATGATTTTTTTGACATGGAACAGCTTTTGATAGCGAATGATG
CATTAGTGCATCAGAATCACTCTACTCCCAATCATGCAAGCGACGAATTGTCTGTGAACG
ACCCTTCGCCTTTGAGCCGTGGCCTGCAGTCAGATGTCAACTCAAACATATCTAGAAATA
TCTCTAACACATTCTTTAAAAAGTCGATCTTTTTCTTCGTTTACTATTGTAAGCAAGCTT
TAGAATTTATCAGCACTGTATTTTCCATCATAAAGTTTCTTTTGAACCGTCGAAAAGTTA
GCTTTTTACTCTCATTTCTTTTGCTTTTCTCGTTGTTTTTACTAATACCTAATGATGGAC
GAGTAAATATTAAGTTTTTTTATAAGGATTTCGTAGACAGAATTCCTTTTCGGTTCATTC
CTTCAAATTTTAATATAAGTTTTGGCAAACACTTGGAACAAGCGAAATCTCTGTTTAAAT
CCAAATTTGGTAATTCCTCTTCAACATATAATGAACGTGATTCTATAATGCCATTGCTAA
AGCTACAGTCAAACCTTACAGAGGCAAAGACACTTCTTTATCAAAATCCAATTAGCCCTG
AAGATGTTTTATTACATTTTTGGGATAGAAATTTAATGAGTACTTATGATCTTAAAATAC
AGGATATAAATGATTCTGTTAACCCTCTACTGAACACTTACCTAGATTTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1200, 1576..3552
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved