Locus Mono:snR56
snOPY snoRNA Orthological Gene Database
Mono:snR56
Mono:snR56
I
snR56
1001..1081
2080
GAGAGCCAGTACTTTGCATCAGCAAACTTGTGAATTTCAGTCCGGGGAACACCAAGAGA
TTCCATAATTTGAAATTGGTACTTTACAGCAGCTGTTTTAGCCGCAGCCTTACTCTTTTT
ACCGCTGTGCTTAGTGACATCTTCGCGAGCATTAGGAGTCTTAACTTCGACCTCTACCTC
TTCTTCCTTTTCTTCAGGAACGTCAAAGCTGGGTCCAAACATCTCTATTTCACGTGACAA
ACGGTCAGCACTAGCGCAAATAGGCATACCGGTGCAGTGAAAGCCCATGGGAAACAACAC
TCGCTTTCCATTCAAGCGTTCAAAAGCTGTAGTAAACTCGACCTTAGACAAAGTGAAGGC
ATGGCCAAGATGCAATGCACCATTCATATAAGGATAAGGCATGTTACCAAAAAATTTAGG
ATATTTCTTACGAAGTTCATCGATCGGAACATCTTCCAAAGGAGCATCGACTTCAAATGC
CTTTTCTTCTTGCCATTTTTGTTGATATTTTTTCTCCAACTCAATTAGAGTGTCACGCTT
CGTCGTGTTTTCCAACTTCAACTTTGCAGTCTTCGTCTCTAGTTGCTCGACGGAAGGTTC
AGTCGTAGCCATGTTGGATACTTAATTCGACGCCCCTTAACAAAACTGAAACAACCCTTT
CGAAATTGCTTGCAAGTTTAAACCCCAAAGGCGACTTGCTTAATATTAGTAGTTTGTGTT
GGCAAGGAGAGAATCCATGGATGTAGCGACTTTTGTTACCATAAGACACTGTCGACTTCA
CTCTCCGTAATGGAAAGCAGATTCCGAGGTATAACGATGCCTAACGAAGTGAATAGTTTC
GAGCAGTCACACTGTATAAATTTATAGACTATTTATTTACTCTCGATTTACCAACTCCTT
GTATGCAAGAGACAAAATTTCATCAGAGTTAGAGTGTTTGTACGATAACTTTTGTTTAGG
TATGTTAATTCATTAAGCTTAGCAGCGTAGGTGGATTTACTATTGTGATGATACCAATTA
CAGACCTGTTCCAATGCAAATCTGTATATGAGGACAACCTAATATTGCCATTATTTCTGA
GTTTTATCCACTGTTATCGAACTTTATACGAATACTGTTCAGCTTTTTATCTTTTTTTTT
TACTGTTTTATTCGGACTAACATTCATTTTAGATAGTAGAAATCATTGCTAGGTCATTCT
ATCCAGATACCTAATTCTACTTGTCTGGTAATTTATAATTATATATCAATACATATCTTT
GTTCGTTCTACGATACAGAATTCTGGTTTTCAATATGGGAGCCACATTAATCTGACTGAC
TGCTTAGTTTTGTAATTTGCAGAAAATAGGCGAGACATTAATGAAGTAGAATATTATTAA
TTGATTGATTTCATTTCAAGTCTCATAAATTGTATCATCAATAAAACATAGAGTATCATT
GCATCTTCTCAGTGCCGCTCATTCTATTCGCCAAAACCGACATTAATGCATCAATCGATT
CTCACAAACATTTCGTGTTCGTAGAAATAAAAAATTCAAAGAAGGAACATTTTAATTACA
AAGGAATGGACAACACATCAAAGTTTTCCTTTAGCTGAGATTTGCTGGGCATTGCATCTT
TGATGAAAAGTCTTGCGCATTGAGAGACGACAGGATCCTTCATAATGCTACAAACTCCAA
CGACTTTTTCACCCTTGGTAAAAAAGCAAGCAAACTTATAGTCGGAGAGGGAGCCCTGAA
TGACCACATCATCAAAACCTTCAGCAGCATTGTTTCCGCAATAGCGTAGTTGCTTTCCTT
GGGCAGACCAAAAGTATGGGGTGAATGATTTCGTCGTATAGCCAGCTTTGTTACCAAACA
AAATATGGTCAGCCGCGACTCTTCCCAAATTACCGGCGACATCCCAATGCTCAATTCGTG
TGTGCGACTTTTCTCCTGATGAAGGTAAACCGGCAAATGGAGCATGTGCAATGTCTCCTA
CTGCGTACACGTCTTCGGCACCTAGAACACGACAATGCTCATCGACCTTGACACCACCAT
CTTTTTCGAGAGAAACGGCATTACCCAAATAGCGAAGATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved