Locus SPAC29A4.02c.1
snOPY snoRNA Orthological Gene Database
SPAC29A4.02c.1
SPAC29A4.02c.1
I
snoR38
1389..1463
3771
TATCGTACTGAAGCAGTGCAAAAAGCGCTTGAGAAGTTTATTCGCCCAGACATTGTCGT
GAAAACCACATTAAAAAGCCAAATGCTTGATGAAAATGGAATGAGTATTACCAAAGGAAA
AAGGAAATCGAGCAAAGCTACTGTAAAGATGCTTCCGGGAACCGGAAAATTTTATGTGAA
TGGGAGTCCATTTGATGTCTACTTTCAAAGAATGGTTCATCGAAAACACGCTGTTTATCC
ACTTGCGGCCTGCAATCGCTTAACAAATTACAATGTTTGGGCTACAGTCCATGGAGGCGG
CCCAACTGGACAGTCTGGTGCTGTTCACGCTGCTATCTCGAAGTCTCTCATACTTCAAGA
GCCTTCGTTGAAGCAGGTCATTAAAGACACGCACTGTGTTTTGAATGACAAACGGAAAGT
CGAACGTAAGAAAACAGGTCAACCTAAAGCAAGGAAGAAATACACATGGGTCAAGCGTTA
ATTTATCTTTGTTTTTACAGATGTACGAATTAATCTATCTTTTTTATACAAAAGTTACAC
TTATCTGTCAGTCATTTCAAAAGTTCAGCATAAAATCTGATATTCTTATATAAGAATGCA
AGTTATACGAGTTTCGGTCATTTCGTCTTCTACTACACAGCGAGGAAAAAACTTATGAGT
TACTACTCTAATGTCATTAATACAATTTTTTTACAACTTTTTACAGTATATTTCAGAATA
ATGTTGATCTACCCTTTGCCATGAAATTTTGTATATGCACGCTTCTTCAAGCATTAGATC
TGGATTAAACATATAAAATCTCAAAACAGAACCTGCTAACCAGAATAATTAAGGAAAGAA
TTTTAAGGTGACACAATGCATTTCTGATTTCTTCTAGTCGTTTCATTGAAAAGTAGAGCC
CCTTTTTCATATTTATTTATGTATTGTTCTTATTTACTTTTCTAGTGTTTAGTTTGTTAA
CCAGAACAATCGGGTTGCCAGGACAACAACATTTTTTGTCCAATTTGAGCTCGTTATTTG
TACATAAAATTTCAGGCCCTTTACAATTCTTTCTCTCCCAACATCTTAGTAGCTATGTCT
GTAGGAACCGTTTACGGAAAAATTGGCTCTCCTCGCGTCCTTTTCTGTGTCAGCGTTGCC
GCAGTCGCAGGTGTCGAGGTCGAACATGTTGATGTTCAACCTCACAACTTCCCTGCTGAT
CTCGCTGCGAAGTTCCCTTTGCAAAAGATGCCCGTCTTTGTTGGAAAGGATGGATTCCCT
TTGTCTGAGACCCTTGCCATCGCTTTTTACTGTAAGTAGCAAAATCCTGTAAACTCCATG
TTGACGATAATATCGTATGGTGCTTCGAACTTCTTCAGAGAGTAGTCAATGTTACGGTAC
TTTGTAACTTTGTATGATGATACTATTTTTTTTTACAGTTATCCCTGTCTAAAGCATAGT
GTTGAGAATGGTAAATCTGAATAATCTTGTTAATATGAAGAAAGGAAAAAGCCCACGATA
TTAATTTATCCAAATAGATTTTTTGAATAACGAAATAATTTCTTTTGTTGATCATTGACC
TGTTTTACTAATTGTCAATTTTAGTGGCATCTCTCAACAAGACTCGTGCTTTGAACGGTA
CTACTGCCGAAGAGAAGGCTAAAGTCCTCCAATACTGTTCTTTTACCAACAGTGAGCTCC
CTGGCGCCTTTCGCCCTATAATTGCTCCCCGTGTCTTTGGCGCTCCCTATGATGAGCAAG
CTGCTAAGGAAGCTGAAACTGCCATTGCTTTGATTTTCGCCCGTTTTGATGAGGAATTGG
CTTCTAAGACCTACTTGGTTGGTTCTCGTCTTACTTTGGCTGATATCTTCTTTACATGCT
TCTTGAAGTTCGGTGCTACCTACGTTCTTACCAAGTCTTATTTGGCCAAGTACACCCATA
TTTATCGTTATTACCAAACCATATACCACCAAGCTAAGTTGGATGCCATTACTGAACCTC
TTAAATTTATTGACCAACCTCTTCCTATTATAAAGGCTGAGAATAAGGAGGCTGCTCCTG
CTAAGAAGGCCGAAAAGAAGAAGGATGAGAAGAAGAAGAATGCTCCCAAACCTCAAGCCG
AGGCTCCCGCTAAGCCCCCCAAGCACCCCCTTGCTTCTGCTCCTAATGGATCTTTTGACA
TCGAAGAGTACAAGCGTGTCTACAGTAACCAAGACACTCGTAGTGGAGCTCTTCCTTGGT
TCTTTGAGCACTTTGATCCCGAGAACTACTCCGTTTGGAAGGTTGATTACAGCTACCCCG
AAGATTTGAAGCAACCAGTCTTCATGACCAACAATCTTATTGGTGGTTTCTTCCAACGTT
TAGAAGCTTCTCGTAAGTACATCTTTGGATGCTGCGTAGTTATTGGCGAGAACGGTGACA
ACACCATTACTGGTGCTTTTGTCATTAAGGGACATGACTATGTTCCTGCTTTTGATGTTG
CTCCAGATTGGGGATCTTATACCTTCACCAAGCTCGACATTAACAAGCCCGAGGACAAGG
CTTTCATTGAAGACGCTTGGGCCTGGGACAAGCCTATTGAGGGACGTGAGGTCGCTGACG
GCAAGGTCTGCAAGTAAAAATGTTTGGGTGAAATGGATAAGGTAGGTTTGTTGGGAAGGC
AATCCCTATTGTTTATTGATAATTCCAAGATTGAGTTTGTTTTAGCCTTAGAAAATGATT
GATTTTACATTTCAAAAAGAGTAGACATTGTGTATGTTTGCTTATTTTTTGAATTCCTCC
CTTTTTTTTCAATTCTCAAATGTGTATAAGGTTTGCTATTTGTGAAAAATCGTTAGCTCG
CTTTATTGTAAATAAAGTCCACGTATGTTTGACCATAGTAGTATTCGTTTCCAAAGCAGT
TCTTGGAATTTTAGTAGACGGCTAGGCGATTGTTTGTACATGCATTGCAAAGTGCACCAC
CCATCGTCAGCAATATTTGCAGTCGTTCTTGATATTTCCAGCTAAAGCATAACTGCATCA
ATATATCAGTCGGTTAGATACATGTAGCGTCTACCATGCACAGAAGCAGTTGATCTGCAA
ATCCGACCAATATCAAGTTATGGGCTAAGTGAAAATTACAAACTCAAAGGTGAGCACAAG
TGAAGCAAATGAAACCAAGCTAGTCGATGCAAGTGAAGTTCATTTCTTTTCTTTGCACAA
GAATTGATTTTGCGTAAAAATAACGATCTCACTGCTACACAATGAACCTGTCTTTTTACG
AAGTTTGCGGCTACAGCGTTCCAATCAGCGGTGAAATAATTCACCCAAAAAGATGCAATT
TTTAGCGTAGTGATTGAATATGAGAAATCGACGTTTACATCAACATGAGGTAAATAGATA
GCGTAGTAGTGGTTGAGAGGGTATTTCTACGCTCGATCCTTCCTATATATTAAGCAGGAC
CATGTTGTTGCGATTCTTTATTAACCAACCACGATTCATACAATTCACATTTCTACGAAA
TAAAAAAGACAGGATTCTAGGGCTGCAATTAGGAAAACAACCGTTCAGAATGAGTAGTAG
TTCAGGCTTAAAGCAGCAAGGGCTTGCACAAAAGAAGAAATTTCAGCTGGAGTTTGACCC
TTCGTCTGTTTCGAAAAATGGAACGAAAACAGAAGCCAAGGTGGTTGGTACGGAATTTGG
CGTATTACTAGTTCGTGCTCGAAACACCTACTTTGCGACGGCTGGAAAGTGCAGCCATTA
TGGTGCTCCCTTAGCCAAAGGTGTGGTTACGTCGGACGGCCATATTGTGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1290, 1584..2771
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved