Locus Mono:snR90
snOPY snoRNA Orthological Gene Database
Mono:snR90
Mono:snR90
I
snR90
1001..1226
2225
TTTGTTGTAAAGAAGCAGATTTACTTTCTGCATGTGTTTATCCTAAAGAATACGAACAT
GATTTACTATTACAATCCCAAGCACGAATAAATTTGCATGGGACTAATCCAACTGCTGGT
AGAAGCTTACGAGGATGGGCAATTGATGCCAAATATGTTGCAGAAAACATTCATTCTTCT
GCTTCAACCTGGTGTTTTGCAGACGAAGAAACTAGAAAGTGGGTAAGCAGATTGTTTATC
CAACGTGTCTTACATTCAAATGAGCGTCTTGACGATGATGATGCAAAGGATCAAAGCTTA
AGGAAGCGAGTTGCTGAAGCTTGGCAACGTTGGAAGGAGGATTCCCGTGGCTGCTTCTTT
ATGACCGATGGACAAATCGTATATAAAAAAGAGGAATAGACTTCCACATAATTATTTTAA
CGAGAAAAAAAAGTATATTCTTTAAATTTACACCCACCATAACATTTCCAACCAGCATGG
ATATACAAAAAGATAATAAACCCTTTGCTTAACAATGTATGTGTCGCATCTTTTGTGCAA
TTAGAAAAAGAAGAAAAAAATTGCTTTTCATGAAACACCTATAATCCCATAAGATAAATA
GCCAATTTTACTTTAATAGAATACATTATTTGAACATATAATCATTGAGTATTTAGCCTA
GTAATTTACAAAACTTATTACTTTTTATCGAGTGCTGGCAACAGTTTATAAACAAAGCTT
GTTACTTATGTTATCTTTAGACGCAGCAGCGTAGAGTAAAAGCTTGTGACTGCTTCATTA
ATTAATGTATATATATTGACAGCAATTATGTTGAGCGACAAACTATTGCTAAGCATGTCT
TTACCGATGTGATATTATAAATTATTGAGGTTGTTTTTTATTCTGACATAGTTTTTCAAT
AAAACATTTTTGCTCGATAACGCTTAAACTTTTTTGGGTTCCATCCTTGTTAAATCAAAT
TTTTTAGTTCTCTTCAAAAAACCAGTTGTTTTAAAAAGAAGTTTGCACTATTAATCAGAA
ATAGTTCACAGTTTATGAGCGTATTTCCTTCATGCAGTGCATAGAATAATGTTTTCATAC
TCACTTTACCCTCAGGTGCTTCAAACTAACTTAGTTTGATTTTTCGTTGCCTGCGGGCCA
TACATGTATGATATATTTCATTTTTCCTTTTCTCATTTGTATTTGACATTTGAATGGTAA
GTCTTTTGATTTGGACTACGTATTGAATGATGATGAACAATATGCTGGCACCCGTCTCAT
CTCTTCGTTATTGTCGAAAGAAATGATGATTATTTTGCTGGACACCAAATACGCTGGGGT
CCCTGATTTCAATATTTAGTTTAAACATTGTTTTTTTTTACTGTTTACTAACATCAACTT
AGATTCTATTTATGCATTGAATTTATTAGTTTTTTGTATCTTCAAATTACCAATTTCTTT
TTTTTTATAGCTTTTTCTATTTGTAATACAGTTTCACTTTATCAACACATTCGGTTAAAA
AGTTCATTTCGTATATTGCCCTTGTGACATTGTAATGTGTGTTCCCAAGATGCCCGGCAT
GCTCGATTAATGATTATCTAACTATAAATAACAATTGAAAACAATGCTTAAGTAGTACCT
AAAATACAAGCGTTGAGCTGTTCAAATTATCGTGTCCAGTCGTCATCGTCTTCTAGGTAC
TGATATGTAAACCGGAAATCTGCTTTTTTTCTCTGCACCCAATCTCCCTCAAAATCAAAG
TATCGATAACTACCACTTTCAAATTCATCTGTGATCATCTTTGGCTCTTCATGGCGCTGG
AACCACGTGGTGTATTTTTTGTGAAATCTCCAGCTTTGCTTTTTCAATTCCTGACCAGCA
ATATACTGTTGATAAGTCCCAGGTCGATAATAAAACATATAAAACAAAGTATCAGGATCA
ACAAGCTCAGTCATTTCAGAAGAGTCAAATAAAGGGAGTGGTTGCTGCGGGTAATAATGA
GGAACAGGATAAGGATCTTTAGGAATATAATATTGCGGTTTGGCAGCATCTGTAGCATCC
GGAACGTACACGCAACTAATGTTAAGGGCCTCGGTTAGCTTTTCTTTGTCAATCGCTCCT
TTGTGCTGCTCCTTGGAAGTATTTAGGGCGTTAACTAAATCCTTGAGATAGTCTGGCGAT
GATACTGGCACATCAGCATTTTCCTCTTTCGTAGGCTTAACATTTGTTTCTGTAGTTGCG
CTACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved