Locus Mono:snoR54b
snOPY snoRNA Orthological Gene Database
Mono:snoR54b
Mono:snoR54b
I
snoR54b
1001..1097
2096
TACAATGGCAGCATGTGTGATTTCAGCCTGTATTGGCATGGGATCGATTATATTTTACG
GCGCCTCTATTCATCCAGTGCCGACGGAGGAGTTAGACGAGAATGACGATCTGCAAGAGG
CAGCATTGGAAAATGCAGCTATGTTTTTGGACACTGACAAAGCTGTTGAGAAAGTGGTGG
AAGGAAAAGATGAAATAAAATAAAAATAAGAGATGAAAGAAAAATATGTGTTTCCTACCC
CCAAAATTACAGTTGGTGTGTCTTTTTTTTTTACTCCGTTTTACGTTTGTTTAAAGGAAA
GGAAAAGAAGTAACGGATATACGCGACTATCTTAATAAGCACCTAAGAAGAAGAAGATCA
AAGTAAGGTGTATGCAATTCGATGAATTACTGGAAGACTAACCCCAGTAATGAATTTTTG
TGAGCGTGTGTTTGTATTTTTTTTTTCTATATTTTCCATTTTATTTACATACTTTAAGGA
TTTTTGTATTTGGAAAAAAGTGCAAGATTTCTTTATTTTTTTTTTTACTATTAGTCATTT
TTCATAATATCAAAGTTTTTAATTTCCCCATTGTTTTTCTATTGTCATGTAGGTATGAGT
ATATTTTGTGGTAGGTAGATCAAAGCAAAGGCAGCAGCAGTATGCGAGATACAAATGTAC
GAGAAAAAGCGAATAGAAGGGCAAAGCGAAAGCGAAAATTGCTCACGAGGAAAAAAGAGT
GAAGAATTGTCATGTAGAAAGTGTCGGTAAGCGATTTTATTCGTTCGAGATGACAAGAAA
TGCTTGATTAGCTTGTCTAACGAAAAATTAATCAAACAGTAACTTCCTTGACGACCTTTT
TAATAACAAGCATACAGTAGAGACAAGAGTAAAATGGTCATAAAACAAAGATGAATTGAA
AACATGAATGGGTGTAAAAACATTGAAAACGTATGCATATCAAACCATTACTCAAATGCC
AGTGGTACCTTTGACTATTACCATATTGGAAAGAGTTATCGCAATATGTTGATAATTTTA
TCAATCCCTAACTATCGTTCTAATGATTGTTGTATAGTAAACCTACTTTGGTAGAAAGGG
CGTTTACGCAACAGATAGGAAATGAAATGGATGCGCACCGTCCAATTTGCATCCGTCTGC
AAGGAGTTGGAAACTTGATACAATTGGCGATTACCAAGGCAAACTAAATAGGTTGACCTC
GGAAATGCTCTGTGTGCACGGCAGCAGCAAAAATTAGGGAAAGGGGTTATGGCGACCGCG
GTAGAAAAAAGGGAGTTACAAAGAAGATGATTGTAAACTATATGAGGAAGGTTGGAAAGC
GGATTCAGGAACGGAAGTAGAAAACCATCTTTTTCCACTGGGTGTTTTTGGCCCTACCTA
ACCTTGATCTGATAGCGCTGAACATTGTGATAAGCACAGTACTACCGATGGAAGGGAAGA
AAAGAAAAAAGAAACTGATGAAAACAAGGTCCAGTCCAACATATATCGAAGGAAAACATT
TAGAAATAGAAGAAATGTGCTTAACTAAGATAAATGTAATTCACCATCTTGCTGTTAATG
GATGAAAAAAGGAAATCAACAAGTGACAAGCCATGAATTGAGGAATTGTAAAAGAATTCG
AAGTTTTAAAAAAATAGAAATGTTATTTCATAAATTAAATAATTAATCATTTATATATAT
TTATTTTTTTAAATTTATTTCTATTTTTTTTTATTTTTTTTATTTTTTTTTATTTTTTTA
TTTTTTTGAATTTCTCTTCTTACTTCGACCCCTAGGGTTAAAGTGCGATGGGATCGTTCA
TGTGACATGACATTTCCTATGACACAACACACTAATGCGCCATAAGTCACGATAACACAT
AATAACACAATCCTATTTTTTCACTGTACTTCGTAGTATTGCATTGTAATCCTTTATGTT
ATGAAATTGTGTTTTCCCTTTCTTTTGGCTGTCTTGGTTCGACGGGTCTTTGATCCCTGT
TCTTTTCTTTACTACTCGAGATTGTGAAATGCAGTGCAATGCGTTGCGTTGCTGCGTTTT
GTTTCTTTCGTTTTTTTTATTATCTTTTTATTTTCCCTTTTTTTTTTTTTTGTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved