Locus Mono:snoR69b
snOPY snoRNA Orthological Gene Database
Mono:snoR69b
Mono:snoR69b
I
snoR69b
1001..1092
2091
ATTATTTTATATTCAATTTAATCTTACAGCTCCTGTAAATAGCCGATCGTTCAAGTATA
TTTTGTATATTTATTTACTCGATTAATGGTATTTGTTTACTTTAATAATTATTATTAACG
GAGATAAAAAGGTTCCTTTCTACTACTAGTCAAATACATAAGCTTCTTTAACAAAAACAA
ACCCTCGATTATGTAGAACAATGCTTGCTGCTATATTCTATAGTCCATCAGCATGAGCGT
TATTTCTGATTCATAATGGTTTACCGAGAGAATTAATGGTAGCAAAATGACCTTGGATTT
CAGGAGAGCCGATTCCGAATAGTTGGGATCTTGTTTGCTAAATCGAATGCTTAATTCTAG
TAACTAATCCCATAACGACTGTTAGATTATCAGAATTTTCTTATTCTGTTCATTCGCTTC
AGGTTAGGTTAATGTGACTGCTTCGTAGTACCGGATGGAAATAATAAAGGTTGCATTTTC
CTTAGTTTATAGCCTACCCAACGCACACAAGTCAAATTGCTTGCAAAAGAAATTTCCACG
TTTGCAAGTGCCAATGATTGTGCGAAGACTATTGCCTCTTTTGGCATGTAGTCATCTTAG
TACTCTTTACTGCATTCTTCAACTTTGTGAAATTGCAGTGAGTCGGTAGGCTACAACATA
TTAATGTAGTTGCTAGGTAGCTTTATAGGATGAACGTGATTAGCTTGATGATATAAACTA
AGACTTGTTTTACCATATTTAAATAAAACTTTGATATCAATCGATAATTCTACTGAAACG
GAAATAATGTTGGAGAGTAGTGAGATACTAGTTGGTAATCTAGCACACAAAGCAAGTAAA
CTAGTTGGTTTAAAAAAAGGATAAATTTAAATCGTAATGATACTGATATATTGCTAGTTA
TATATAAAGCACTTTTAATCATAGTCTTGAAAGGTTTGCATTTTGTACGAGTGGAAGCAT
ACTATTTCAAATGATATAGGCATGCGTTCGACTCATGCTGCTACCATGATGAACACGAGC
CAGAAGGCTCAATATTCTATTAAACCCAGCTCTTTGAACCAATAGTTGTGAAACGAGAAA
CAAGTTCTGAACAGCAGTTTGTTTAAACATTGTTCGTGTATGCCTGGATAACTATGCTGT
TGAGAAATTTTGTTTTTTTTACTAAAAAAATGTCGTGCGACTACGATTTCTCGCTTTGTT
GAATAAATCAAAACACCATTACGCAGACTATACATGCATAAAGAGTATTGTAACCTTTTG
TAAGATTCTTGTCATAGTAAATAAGATATGCTATGTTCCATTCTGTGCGTATATATGAGC
AACATAATCATTGATATATAATTACATAACTAACCAAAATTTTTAACTTATGCTTTATTA
CAGTGCCTTTTAAACAGTTTATGTGTGCAGAAAACGAGACTGCAATAAACATATTCTCTA
TAACCGTCCGTATATAGTAATGTACCATGGTAACAAAACTATCGTACGTATTCTTCTAAG
CAGGTAGTGCGAAGGTTTTGAGAGAATCATGCGACCAGTTGATTCTTCCATAAACCAACA
CCATGGCATCTACACAAGTTGTTTTTATAGTAACCTTATTTCTTTATTTGCTAATCACTC
GCTGGAGAAGGAAGAATGAGAAATCTTTTATTGCAAGCGAAGAGCCAAAACAGCCCGAAT
GGAGAGATTATACTCCAGCAGAACTGAAGGAATATAATGGCTCCAAAAATTCATTGGTTT
TTCTTGCTATCAAGGGAACTGTGTACAACGTTACAATGGGATCAAAATTTTATGGTCCAC
AAGGCCCTTATAGTGCTTTTGCCGGTCATGATGCCAGTCGTGGTTTAGCAAAAAATAGTT
TTGACGATGAATTTATTCCTGATTCAGATGCAGAAGAATTGGATGATTGCAGTGATTTAA
ACGATGAGGAGAGGCAGGCTCTAAACGATTGGAAAGCATTTTTTGACCAAAAATATCAAG
CTGTTGGCAGGCTGATAAGTCCCAGAGAGGCCAGAGCAGCAGCTACTATTTCAGAAACCG
AAGAAAAAGTTGCGCATAATTAATAGCGACAAACCTGTTTTTTATGACTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved