Locus SPAC4H3.12c
snOPY snoRNA Orthological Gene Database
SPAC4H3.12c
SPAC4H3.12c
I
snr62
1379..1453
2574
ACTCGACTGGCTAAAGGAACTTTCACAGTTCTACATATTACAGGTATTAGCAAATCATT
TATAAATATAATTAAGGGAAGCTGAATGAACGACAAATAGCTACTTACACTTTATGAGGA
AGCACGATCATTTCTGACATTTTAATAGGGAAATCGTATTCTAGGACTCCAAACTTTTTT
AAAAAATCGAAAAATAGATTAACACTTCTTCGCAATCCCGATCAATTAAATATTCATTAA
GCACAAAGTCAATAAAGCCACGTTTATGCAAGTAGTGGTAGAATGCTTTGTAAGACCAAT
GAATGTAATTTTGTCTACTGAGGTGGTACTAAGCCATATAGCTATTAAAGAACCTTACTT
AGATTATATTTGCAATAACATATAATCTTTTAAATGAATACGAAATTCCCTTTTAAATAT
TAACATCATTATATTAAAACAAGGAAGTTTTATAGGTATATAGTACATATTGAACCGATA
TATCTTTTTATAGAATATAATTGAAGAGTTAAGGATTATACCGCTTATAGTAGAATAGAA
ATAGACCAGGAAAAAGCTTACAAATTAAACCTTTATTGGCTTATGCCATTTGTTCTAAAT
AAAAGGCTCTTTCTTAGCATGCACTTCATCAAAAGTATAAATTAGGTAAAGCATAAAAAA
ACTGATTGTTATCTTCAAGTTAGCTGTTGTGCTATGTCAATTTAGTTGCATAATACATAA
TTAAAAATACATATGCACGTTTTTGTGTTTTTAAATAAGTTTTATGCAAATTTACATCGA
CATTTAACATTTGGATAATTAATTCCAATTTTAGGCAAAGCGTAAATTAAAACCTATTCA
GCTAATTCATTTATAGTATTTAATTTGCCAGTTAAATACCCCTTAACTTGCAATTTATAC
AAATAAATAAATAATAATATTATTATCTTTTAATATCGTAAAAGGTTGAAAAGTGCTGCT
TTAATATTGTTTTAATAGACCAACGAATAGAAAAACACTCGATGATTGTAAGCAATCGAA
ATTATAGCCACAAAAATTTTAATGTAACAAATAATAATTTTCAAGTCTCTTGTTTTAACC
CAATCCTTCTAAAGATTATTTTGTTCCTTAATACAATAGTGTGCATTTTTTATGTTTACA
AAATAGCGCTTTGCAACGAGTATATTCGATTTCTCGCTAAGTGCTTTCTATATATACTAA
GGTGTATGTCGACTGTATCTCTTCTCTCTTCAGCACATAAAATGAACTGCTGCAACTTTT
ACTCAAATTACAATATTTTGCTAGTATCAAGCCTTTTCTTCTTTTAAAAGAAAAATTTTC
TTTTGTCTTAACTTCAGGAAGTTGTAATAGGTATGATATTTTATGGTATTTATTTAAAAC
AAAGTGATGTGAAAAAAATTCTTATCTACATTGCCTGAATCATATAGATGAAAAACTATC
TTGTTTACTGATTGTTTTATTCTTTTATCATTTTCTTTATATTTAGAAGCCAGGAACTTA
ATCTTTACTAACCATTTACTAGGTTTACATAGTTTTTTTATAGGTCATTTTTAAATAGTA
ATCAACGGCTTTCCCTGCAGTGGTGTTAATTGTGTATCTAAATTTTATATGCTCCTTGTG
TTTAGTAGTTTGATTTGTATAAAATCGTTGCTTGAAATTTCTTTCTACCTTTTTGCTTCC
TTCATTACTGTTTTTTTAACGCGCCCATCCTGGTGTCAATAAAAAAATATATATGCCATG
TTTGAGAGTAAAAGATAGTAAATACAGCTTCCTTAACCGTCCCTTTCGAGGTTCATAGAC
CCTTACACCAAATGAACTGAAAATCAAACTTTTGTATTATTCATCTACGATACTCATGCT
CGACGAATCAATACTGTCAAAATTGTATACACTTACGAACAATTAATGAATATAAAAATC
AACGATTTTGATATTTTCTGTCTAATTAATCGTTTAAAGTCGACGCGGATCTTTTCAAAT
ATTTTTTGGCTTTATTTTTGTGCTAGCTAGAATTATACGGACTAAAATTAAGCATACAAA
ACTATAAACACTTTAATACTCCACATTCATACGAAAATCAGATTATTATAGATGCCAATA
AACGTAACAAGGTGTGCAGGCATTGCAATCAAGTATCCTTCCAAACGGTTCATCTTGTGA
ATGATCCGGGATGGCTTTTCAGGTTACTCACAAGCTATCATCATACTTCACTTGAATGTG
GAAGGATTAGTTTTTCGCACACCCAAAAGGTCCCTTTATATATTAGGATTGTATCGATAA
CCCTAACCCTGAAGACCAGCGACCTTGTGCCTATTTCCTTAACTATACTGCATTCGACCA
AGAGTGTGCAATTTCAAATATCATTCTAATTCTCTCTTTTCCTTTTGTTTTTTTAAGGTA
CTGCAGAAAAAGTGCGATATTTTTCCAACCACTTTCATCACTACAGTATTTAGCTTGGTT
ATCAAGTGTTGCTCACCTTTGCTCATACTACCTTGATTATTTGGGACTAGCTGCTGGTTA
GCATTGTTTATTTATCCCCCTCTTCGTGTTTTTAGCAAGGAAGTCGTGGTGGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1574
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved