Locus Mono:snR30
snOPY snoRNA Orthological Gene Database
Mono:snR30
Mono:snR30
I
snR30
1001..1327
2326
ATCCTCTACGCTACGCATCGTGCGCAACACTTCCCCAAGTTCAGCATTACTAGAAAACA
GAATTAGAAAGTACATCTCAAATGGCACCGTACGCGGTAAACATCAGAAAAGAAGCACTC
AAATTGGAGCTTTGAGGTTCATTAAGAATCACATATACATTGTTGGGTTCATTTACAGAG
AATCCATTCAACCAGGTAAATACAATTGGTAGTATGGAAAGTAAAAGTTCGTAAAACATA
ATGAAGCTTAAACACGAGCAGAACTTTCCCTGTTATGAGAAGTAACTAGTTCAACTAACG
TATGACTCCAAAAGTAACGCATAGAAAGTGGATTTGAAGGAATTTAACTGAAATTGCCTA
AGACAATGGTTAAGGGCAAATGTTAATACCCTGCTAGAGATTTGACCTTAGAAAAGAGAG
CTCTTTGAGTATAAATATTTATTTTTAGCAAATCAATTTTTGTATACAATGTTTGATGGG
TAGATCACTGAAAGAATCTGCTAACGAGCATAATCTTATAAATGACATTTGCATAAGCGT
ACTGATAGTCGCTATGTCGAGCTGTTATTACTGTTGGAATATTTAAGTTCTATCAAAGGA
ATTATAAAATTTGCATTCGTCTTTTATAATGGTTTTTAATGTCTATTAAACAATTCATTG
TTGCTGATGAATGTAAACAAAAGCAATAAGTTTAAGTATAGGAAAGCTTCAGCTGTTCTA
GAATACAAACTCAGTAAAATGTTATAAAATAATATTTCATAAACCCAAGTGGCATATGTA
TCTTAAGACATTTTCCCAATATCTGCAAACTAATTCACTACTTTCGATCAAATTATATAC
TGTGGTTGTTCATAATGCACAATCTTATTTTAACGAGCCTTTTTTTTTGCTTTCTGGAAA
CACCAAAATTCCTAGACTACTAAGGGTAAAACAGTCACTAGGGTTAGGGTTGTAATTTTC
AACAAACTATATAAAGTCTCGTTTGCACTTCGTTATAACCTATCATGAATCTGAAGTTAC
ATTGTTCAGATTCTTTCGAGAATCTTGCGTGTAACATGGTTGGCGTGTAGAGGTTGACAA
GAGTACAGACAGGGCGGCGATTGTCCTTGCAGTTTCGACTGCAGGTTGAGAGTTGGCGTC
TTGCCATGAAAATTGACTAAAGGATGCTGCGTAGCCTAGCCAACAGATTCTAAAACGATT
GGAGTGATCCTGATCCTTCTCCTTTGGAGAGGAATTGGTTGATCCTCTGACAACTGTATA
TTCCTAAATCTTTCGCTACATGATCTCTGGATCCTTGCAGTTGGGTAAAACCATACAGTT
GACATTTTTCATTTGGGTAGTTCTTCTTTTATGATAGTTTAATCATGTGTATGAATACGA
TTAATTATTTTATTACAATTTTACTTTGTCATTTAAAACTGAATTTTTTAAACTTCCAAT
TCGCTGTTAATGAACAAATAAAAATGGGCGTTGTGATGTTTTGATGAGAAACAGGCTGAC
CTGTCGATGTAGTTTTCGTTTGTACAGCTTGACCGTTTGAGGTAGGTTGCCAGTATGGTA
TTTTGTATACTTAAACTGAATTTTTAATGATAATATTCTCGTCATATTTTGAGGTACTTT
GTTTTCGTGTATAAGTCCTTGTCAAATTAAATGGACTACAAAGTTTTTAACAATCAGTTT
TGTGGGCTGTTTGTAGCAACATCACAAGTGTATTAGCAATAAATGATTTAGAAATGCTAC
CCTAAGAGAGTATATAAAAAAAACCTTTCGCTCCTTTTCATCGTTTACTAGGTCGTTGAA
TTGTCAACATTTCAGTCTGATTTGGCAATTACAAGCGAATGATAAAAACCAAAAACTGGT
TGCTTGTTCAGCAGTTGTCGACGCCGACGGGAAAGCCTGCTAGCTGAAATAATTGTCAGG
ATGCTCAATATTAGTAAAGCAATGAGCAAATTAAAAACTATAAGTTTGTATCTATTCCTG
TAATTGGGGCTACCGTTTGGACATAGGCCCGGTGCACGCAGTTTTTGAAGACGAGATGAG
TTAGGGTGCTCTAATATAATCCTTAATGTGGAAAATAGAGAATCTTCTTCTAACGTAAGT
GAGTTGCCGTTTCTGTCACTCACATAGATTACGCCTTTCGAGTGATCTATCACAAACACT
GGTGGTGTGATAGAATCTACATAAACAGTATGGTCCAAATTTTCCACAATCCAATCCAAC
CATAAAGAAGAATCTAACCATAAAAATGAAACTGACTCAGTATAAGTAGGATGTGATATC
TTCGAGTACTTAATTCGCTTCACTTTCCTCGCGAACCCTTTCTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved