Locus Mono:snR101
snOPY snoRNA Orthological Gene Database
Mono:snR101
Mono:snR101
I
snR101
1001..1274
2273
TTAAAATTCAGACATTTGTGAGCGCTCTGTAACATGTTCGTATTTTATAAGCATTTTGG
TGTGTATACGATTCGTGTTCGTCCTTTTTCCAAAGGTTACAAAGGACGTTGAATCGTGTC
AGTATTAGCTTGATCGAGCTTTACTTTGCTTGAACTCTCTAAGACTAGCAAGAAACTGAG
GTACTTACAATAAAAATAGCGAAAAAGATTTTAAATTTGTTATATCATATACCTTTGCTT
TAAGATTAAAATCATACATCTTTTTACAAGGCAGTAAAATGTTGTTTCAACTATGTAATT
TATTAATTAATGTTTGGGAGCACCTGTCTAACTACCACGTTATTAGCCTACTAAACGCCA
TGCAGGCTTTTGCTTATAAACTATGATAATAGAGAAAAGTATAAATGCTAAGCAACTTTC
TTTAAAGTTGTGGGATTCTTTTGTCAAAGAAAAACAAGTTTCTTTTGTGGCTGAAGGAGA
TGCTACTGTAAAACTAGTAAGTCTAGTTGAACTATTAAAACGTCGTTGTAACGAGCAGAA
AATTCCCTTTAATCAAACGATTGAATTAATTCCTAGCGAGGAGCAGTCTTCTGACACTTT
GATACACGGAAATCGGAGATCACTTCCTCAGTTGAAGATCGACCTACAGATTTTGGAGCA
TGACAGCTAAATAATACGCAAATTTTTACTCTTTTCAAAGTTACCAAAAATATTCTTCTT
TCATTTGTATTCATACTTTATAGACGCTAATTCCCTGAACCAATCGATTGACAATTTACC
AGTTTACGAGTTATATTACTGTTACTTTGTGAGTTTTTTGTTATAAATGATAGTACATTA
ATCGATGAAAACTCGATTTACCTTCTTCAATAATTGATGACCTGCAATGTCCTTTTGCCA
ATTTGTAGACGTCTAATATTATTTTTTCCATTCACGTCTTTGCGAATGATGCTATGGTAA
AAGGGTTGAGTGGAACGAAATTAATTCATAATGCTGTTTTTTTCGCACATGGAATGGTTC
AAATTGTGAAAGTTCGCTTTTTGGTCGCTCCAACGCTGCGAACAATAAAGTTTTGGATCT
TCAATTGATTTCATCAATTCACTCTTATCCTCTTTTTTTTAGATCGCTGGTTCTAGCTTA
CACTGTATGATATGAACCGCTCTAGAAATTGGAATGAGATTCAATTGGTGAAAGTGAGGA
TCAAACTTGTATGGCTACGGAGTTTTTAATGGAGAGACACACCTTTAAGAATCTAAAGGC
CCCATACAATAGCGCTAATCTTATTATTAAAAGCACTCTTATGGATTTCTCCGTTTTAGA
GATGATACCAACATTATTTTCAAGCTGACGCAAGACTATTTTGAGTATGTATTAGAATTT
ACATTAGCGCTTTAAAGGATATTGACGTTAGCCAATCGAATAAAAAAGGAAATTAATATT
TAAATTAAAGCATTAAGTTATCAATTTTTTATTATTTACCGTTTAAATCATTTACACATA
TTGGAATCGACCCCCTCGTCCACTATTAAATGTTTTCCCCCATTCGACAGGATCAACTAT
TTTTCTAGCAGATAGTCGAATTCCTCCTTTTATAACCATTACATGGTCTAATGTCTTCAC
CAACAGAAGATTTTTCTCCAAGAGGGCAAACTCTCCTGGCTTCATGTGAATCCAATCTTC
TGCTGATGTTGAGTGCAACGGATGAACGTCGTACAAAAAAACTTTTTTGTTATTTAAAAT
GCACCATACGTGATTAAAAGCTCTGCTCATGTTGTATATTTGTTGCGTGTTCATGCTTTC
AAAATTAACATGAGCATCTTCAGGTGTAATTTTTTTAGCCCAACTTTCTTGAAATGATGG
AAATGTTTCTTTTGAAATTAGTTGTAGGCCTCCTGTATCTGTAATCCGCCCATGTATTTG
AGGAGCTACGGTATTTGTTTGGCAATTTGGTAAATAGAGTGATTGTAAAAGGACATGTTC
TAACATGCCGGCAGCTCCTAAACTCAAAATCTTTGTCAATAGTGTATATGTTTCTTTCCC
ATTTAATTTAAGGTACGCTTGAGCTAATGATTTCCCCTTATCGAACTGCTTTGAATCCAT
TGTTTGGATTGTCACACCGGCCAGACGGTCACCATTTAATATAGTAGAATAAACAGGGCC
TGCTCCACGATATTTTGGAAGTAAGGATGGATGTATATTTATCCCCCCATATGGCAGTTG
ATTCAAAATTTTAAAAGGCACAAACCTTCCAAAGCTAGCCGTAATTGCAAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved