Locus SPAC6F6.03c
snOPY snoRNA Orthological Gene Database
SPAC6F6.03c
SPAC6F6.03c
I
snR191
2132..2260
4276
ATTTTGGGTGATTCAATTTTTCGTCCCTTACTTGTTCACTTTAATTTTAGATGCAAAAG
CATTAAAAAGAAGGACACGTGGTATTATTGGATTAACTATTCAAGCTGTGGTAATCATGG
CTACTCTTTCTGGTGAATTGGGTTGGATTGTTTCTAAGCACATTGATTTACACGATACAT
CCCCTGATCTTGACTGGACTCAACGAGGTTACGGAGGTGCTCTGGTTCTATATTTACTAA
TGGGTATTCAATATGGTTCTTCCATTGTCTCTGTACAGTGGTGTATCTCACTTCTCTCTA
GTGATCCCGACAAGTATGCACGTTACGCTGGACTGTACAAAGGAACCCAAGCAGCCGGAA
TGTGTGTTTCTTTTGGTATAGACGCAGCTGGAGTCTCATTTCTTGGACAAGGAATTATAT
ATTTTATTTTTTTATTCGTGATGTGTGCATCTCAACTCATAATGACTTCGATATTCGGTA
AGGAAACCGATAGATTATCAACGAAAGAACACTTCACTGATGATAAATCATACATCGATG
GAGTCATGCCTTCAACTGATACGTACATGAATGAGAAAACTTCCGATGAGCTGGACAAGA
AGTCGCTGCCAAGCGACCAGGTCTACGTTTAAAGATTTTATTTTTTAAGAATTATTAAAT
CATTTTATCCTTTTCATAAAATTTCACTGATATCTTGATGCTTATCATATTGTGTTCAAA
TCCTCTTAATTTAGAAGTATGGTATATTCAATGAATTCTGTGACTTAAAAGTTTTTAATT
TTGGTTATTTGAGAACATACTTTTTTCATTGCTTTCTTTAAGTTTTATTGATCAAAATGT
CAATAATACATACATTTCACCATCTGTAAGACATTTGTTTTGGCGTTTTTAGACTAAAGT
TATAGTACATTTTCCATTCCAAGTGAAAAACCATATAGGATTTTTCTTTGAGATTAAAGA
AACAATATCCAAAGTTTTCCTTTATTAACTTAGGAATTTAGCTACATTTTACTAACAAAT
GTGAATAGTAAACAAATGTTACCCAGCATATGTTACCTGTGCTTATGACTTGAAAATTTC
GCTTTCTTACTTACACTCTACCTATCACCAACCGCATCAATTTGGCGTGGTTGTTAGGGC
CTTGTTTTTGTTCTTTTTCTTTTTTGGAGTAATCAAAAAAAATGGGCACCTATAAGAAAG
AGAAAAGCAGAATCGGACGTGAAGGTGCTAATGAGAAGAAGCCTGGCAACCTTCGTGTCA
AAGGTGAAAATTTTTACCGAAATGCCAAGGATGTTGCTCGAGTTAACATGTATCGAGGAG
GCAAGGCGAAATATAACGCTGCTGGTGAATTAGTCCGTGCTGCTGAATTTCAGTCTAGCG
AGGTTCCTAAAGCTCGAATTCAGCCTGATCGACGATGGTTCAACAATACCAGAGTTATTG
CTCAACCAACTCTCACCCAATTTCGAGAGGCTATGGGTCAAAAGTTAAACGATCCTTATC
AAGTTTTATTACGAAGGAACAAACTTCCTATGTCTCTCCTACAAGAGAACACTGAAATTC
CAAAAGTTCGTGTTTTAGAGTCAGAGCCTTTTGAAAACACTTTTGGCCCTAAATCTCAAA
GAAAACGCCCCAAGATCTCATTCGATTCTGTGGCTGAATTGGCTAAAGAGTCTGACGAAA
AACAGAACGCTTACGAAGAGAAAATTGAAGAGCGTATATTGGCTAATCCCGATGAGTCTG
ATGATGTTATGCTTGCTGCTCGTGATGCGATTTTTAGCAAAGGACAATCTAAACGTATTT
GGAATGAGCTTTACAAAGTTATTGATTCTAGCGATGTTTTAATCCAAGTGCTTGATGCGC
GTGATCCTGTAGGTACTCGTTGTGGAACCGTAGAGCGCTATTTAAGGAACGAAGCTTCTC
ATAAGCATATGATTTTGGTTTTGAACAAAGTTGATCTTGTTCCTACCTCTGTTGCTGTAA
GTCATTTTTGTTTTTAAAATCTATTTGCATTGTTTTTGATACATGGAAAGATCAAGCTAT
ATGCATCTGTTATGCATTAGTTCTATTTAATTGCTGGAATAGTATTCAGTATGCCCATTG
TTAAGTCAAGACTCTTTTGTATGCTTTTCAGCATATTTCCCGTCAATTGAAGTCTGTTAC
AACTCTGGGAGAGTATACAAACTGTCTCTAAATTATATAGCCGTTCTGGCTATATCAGAG
ATAGTTGTATTGTCTTTGCTTTAATTTCGGTGTTTCAAGCAGTATATCGCTGCATATAGT
TGTCACACTTACAAATGTAAAGACTTACATTGTTTTCATGTATCAACGAACAACCAGATA
TATCTTTATTAACCAATGTTCTTTTTTCTAACTTTTTTAGGCCGCCTGGGTTAAAATATT
GGCTAAAGAGTACCCAACCATTGCTTTCCATGCATCTATAAATAATTCCTTTGGTAAAGG
GTCCCTTATTCAGATTCTTCGTCAATTTGCGTCTTTACATTCTGACAAAAAACAAATTTC
TGTTGGGTTAATTGGTTTTCCGAATGCCGGAAAATCAAGCATCATCAATACTTTAAGGAA
GAAAAAAGTTTGTAATGTTGCTCCCATTCCTGGAGAAACGAAAGTTTGGCAATATGTTGC
ACTCATGAAACGAATTTTTTTAATCGACTGTCCTGGTATAGTCCCACCCAGTTCCAACGA
CTCTGATGCAGAGCTTTTATTGAAAGGTGTAGTCCGAGTTGAAAACGTGAGTAATCCAGA
AGCATATATTCCTACTGTACTCAGTCGTTGTAAAGTGAAGCATCTTGAGAGAACATATGA
AATATCTGGTTGGAATGATTCGACTGAATTTCTTGCTAAACTTGCGAAGAAGGGAGGCCG
TTTGCTCAAAGGAGGTGAACCTGATGAAGCTTCGGTTGCTAAAATGGTATTGAATGATTT
TATGCGCGGTAAAATCCCTTGGTTTATTGGACCTAAAGGCCTTTCCTCATCAAACGATGA
AATCAATTCTTCGCAAAAAGTCGCTACTCAGCAAACTGAAGGTTCTGATCAGGATGGAGA
AGAAGCAGAAGAAGAATGGCATGGAATTTCTGATGATGGTAAAGCTGATGAGTCTGAAAG
TACTAAACCAGTAGCCGAGGGAAGTGCTTCTGAGTCTACAGATGAAAGTGCTGTTGATGA
TAATAAGAATAGGAGTTAATTGGGGGGTTTGGTTTAATTTATCATTTTTATGGTTGGTCT
TTGTATATTAATAATAATATTGGTTTACTAAATATAATGTGATATGTATAAGAGTTGCTA
TTGTTCTATAGAATTCTACCTGATGTATTGTAAACGGTTTGTTAGATACAATACTTTTGC
AAATTGTTCATCAATATCTTGCGTCAAATCTTTTTTTTTAATTTAAGCGTGGTACTGATT
CTGCTTGTTCTTCTCACATGAAGTGTTACCATTTACCACCATTTTATGTATCGAGCAATG
CAAATTACTAGTCATATAAGGTTATTTGGCAGTTACCGTTTAAATTATTTGTAAGTTTAG
ATATTTAAAAAAAAAAAAATTGTTTGAAGATACCAAGTTATCACTCAATTATTTGGCGTC
GAAGACTGAGGTTTTGCTACTGCCTAACACCATTGTCAGTACATTAGGACAAGGTTATTG
CCAAAATTTTAATCGAAAGCTTATACACTTAAATTAACTTTTGGGAGTAATGATATCTAG
TTTGGCCTTACCGAAAGATGCAGTCGTTTCCTCCTGAAATATGGCATCACATATTCGATC
ATTTAATAAGTTTTGACAAGTTTGAAGCAAAAAATTTTGGGGGCTTGCTAAGGATTTGTC
GTTCATCATATGTTGGAGGCCTACATGCTATTTATTATTTTCCAAAGCTTAATCCCCGTA
ATTATCATAAGTTTGTTGACACGATTAGCCGTAAACCTACAAGAAAATTAGTGCATCACA
TTAGTTTAAACAATGTTTCATATGCATCAAAAGCTTCTATAACATCCCGTCTATTGAGAA
GGTGCGCTACGAATTTAGAAACATTTTCAGGTCCGCAGTCAGGACTTGGTTTTACGGCCT
TAAGAGCATTCTCTCAATGCCAAAAATTAAAAAAGATAGACCTGTCTATCCTTTCTGAAA
AAATTGATTTACAATATCTATTTGGGGGTATTCAGCATCTCAAGCATCTTGAGTATATCA
TATTACCCTATCTTTCAATTCCTGCTCCTATGTGTACTGAATGCTGGCCAAGCTCTCTTA
CCTTTGTGGGCTTTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1975, 2380..3276
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved