Locus Mono:snR79
snOPY snoRNA Orthological Gene Database
Mono:snR79
Mono:snR79
I
snR79
1001..1083
2082
CTCGAATTTCCGTATGTTCGTCTCCTCTTAGGATATCTCTTAAGAAAACTGCATCTACA
TCCATTTGCAACTAAAACTACAGTTAGTGATTTTACAATTTAAAGACTAAAAAAGCTTTT
ACCATTTCCAACGCTCCTCTAATCACTCCACATAGGATATTAGAATACCATAATTTTTGA
CGAGCATCAGCCGGTAACTCAACGAATTCAGCTAAAGGGTTATCGTCGAGGGTAAGGACG
AATGTATTTCCATCATCCGATACACTGGAAATGATAGGAGAAAAGTTCAAGAACACTTTA
AATCCAACTTTTGCAACTGTTTCACCTGTCTCACGAAAATCTGCGCAACGAGGCCATTCA
GTTTTGGCTAAAAAGTCTTCGATCAACCGAATGCCAATGTTATAGCCCCTGAAATGGAGT
TAGAATATCCCTCTTATATTTGAAAACAAACAAACATTTTATCCAATTCTTCGTTCACCT
TCTCATAATTCATGTCTTTGCACAATTGTGCGACAATTGATCCATAAGTTAAAACAAACA
GTTCCGCGTTCTTGATAGTCTTAGTATAAATACATCAATATTGATAAAAGTAAACATACA
ACTTTGTCTACTTTCTTATAAACATCTTCACCGATTTTTGACTTCGACATTTCGCCTGAG
TCGCAGTTGGCTTCAACGTGTAATACTATTAGCAAAGAACACAATCTAAGGCTTCACTTA
AACCCTACCCTAATCAAACTCAAGATACCATATAAAGGAAATTTTAGCTGTCTACGAACT
TGAATTAAACACATATCATATTGAAATGGTAGAGTAGTTTTTAACAAAGGTTGTGATGAT
GAATGGGGTTTTTATCAAACTTGCACCGTCGATAGTGTACTGTTGGCTTGGTGATTAAAA
GTAATGAGAAACTTTCAATGTCGTGTGCAATTCTACAGTAGTGAGTCATAGATTTGCTTC
TGAAGAAATGTCAAATTTGCTAATAGCTCTTATGAAACTACGCTGATGACACTGTATTTG
ATGCTGGAGAATCCGTTCGGTGAAGGCACAATGATTTCTCAAAAGACTACAACGGTATCT
GAGTGGTACAAGAAGACAAATGCATATTTTGGCTTAAAGATTTTTTTTAATCTTCAATTA
AGTCTTTAATAAAAATATTTTTTAATTAAAAGACCTAAGATTTTGTAGCATGCTGAAAAT
AGGCAAAGTTTTAAAAAAGAAATTGATCGTAACACAAGTTGAAAACGTTAGGGTTTATTC
TGAATGATTTTATGTGAGGCAGTTTTTAAAATTATTCTCGTATGGTGCTGTATACTGTAA
GTTTAAGTAGCCCGCTTTAATACATTGTTAGACATATACTTAGACAAGTATATCCAGCCG
TAGCGAAACCAAACCATTTGACTTTTGTGTCCTCGTACCATAGCATCGCGTATGCGCTGA
GTAGATTTTCGATCTGCGTGAATGATTATTGTATCGTTTCGACCCGCCTGACTTTGGACA
AGAGTGGGAATGGTGTCCAAATATGAGATGTATTTTCGAAATATATTAACCGACTCTAAA
ACGAAGACTTGAACTTGGGGAGTAGCTTTGACAATTTTCCTATAAACAAGATGATATTAG
CTGACAATCGTGTAAATAAGTAATACTTACATGGCACCTTCGTAACATGCGATATGGTTT
GGGTGACCGGATATTCCTTTATTGTCAAAGGTAATGAGCTAAAATTATATTAGATGGTCT
ATTAATTGGATAACTGACCAAAAATAAAGCGTACCGTTTTAATGTTGTAACGTTCAATTA
TTTGAGAAATGTGTTTCGCTACATCGGTTGGATCCCATTTTGCCTGCATACCGTCTTGCA
ATTGAGGATCTGACACAACATGAACATTGGTTTTATCAATTTGGTACTTAGAAGCAGCGA
CGACCAACTCTTTTTCTCTAACGCTTCCGAGCCCATCGGCATTGCCTAAAATCGGAGTTA
GTTCGACACATAATTGATAAAATGGAAAACTGGACCAACTGTTTCATACCATTAGAAAGA
CACAAAACATGAACTCGAGTAGAATGCTGATTGCCTAAATAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved