Locus Mono:snoR02
snOPY snoRNA Orthological Gene Database
Mono:snoR02
Mono:snoR02
I
snoR02
1001..1085
2084
ATTCCGAAAAGACATGAACATGAAATGGCTAATGCATATGCATGCTAACGAAAATTTAA
AAAATGAAGAATATGCCGATAAACGCAATAGCAATCCTTTTTATTTTCTAATTTGAATGA
CCATTCTAGTCGCGTTATTCCAAGTCTAGCATCCATGCTACGAGAATAATCGTTAGACCA
ACAATCTAGGGCTCAGTTATGCATTTGCTGTTTTTACGGGTTCAAAATCTATACAGAGTA
GCTCACAAAATTCTTTTCTTTAATGGAGTGTATACTCTATTCATAAATATTGAAATTCGA
AGAACTGACGCAAACCGAGCAAATTCGATAAAGCATTTATTTAGCTAAAGGGATTTATGC
TTTTAAATTATCTAAATTTTATTTAACAATTAGTACTGGCTCTATATTTAATATTTTTAA
GACATTTACATATTCACCATTATTCCCTCGAAATGCCAATATGCTGATATAAAGAAATAT
TTATTACGCTGCACTAGCTATAGTAAGATAAAAGTTGCTTTCTCACATGTATGCCTGCGT
TTATAGTCATTCCCTTAAAAAGCAATTATTCTAAACCTTTTATGAAAAATATATTTTGAA
GTGCAGTTGAAGCTGGTAGAAGTTGATTTTACTTATTAGCTTATTAGAACTATTACAAGT
TACGCTAAATATGTTTTTTTCATAATCCATACTACGCTACATCAGACAAGAGGCGCTTAC
AGCGGTCGAATGTATCCTTAAGAAGTTCACATTATGCAAATAAACAGCAAATCACAAAAT
TACTTTAACGAGGGAACTGAAATATATAATGAAACCTTAGTAAAATGTGACTGTCAATGG
TGCAAGCTATAAAATCAGCAACTTGTTTATTCTAATATTTGCAATAGTTGTGCGGAAAGC
ACTTGTGTTCTTAGCAACTGTTTGTTTTATATTTTAGAAACGCTTTTTTAAAAGTAATAA
TGAGCATTTGATAAAAACACTGGTGCTAATTCATTTCAGTGTCGAATGATTAAATGTATG
AATTTTTATCAATCTGTCAATCCCCTGAGATTTTCATTGAAGAGAATATTCATCGAATTA
TGACGGCATAAAGATACGAATTAAAAGATTAGACTAATGTTCGTTTTTATAAGATGTTAA
TTTTCAAAAATTTATAGTCGGTACACAAATGAAAAAACTAAAAATTTTGTTTTTTAAAAA
CCATGAGTAATTAAAAGTGAAGTGTTTAAGCTTTTTATAAAGTTTATTTTGCGTATTAGT
AAAGAGGGATCAGGGTTTTCTGTAGTCGGATGTGTATAGCTTCAAAATAGTAATAAGCGG
CACGCATACAGCGATTAATGAAGATAGTTTAGTACTAGGAAAAACATTCCATGCGTATTC
TTGTAACATCCATAAGCCAATTACTATCGGAGCAGGAAAACTAGCTTGATAGCATAGATA
TGGTGAATACCAAGCAAACCATGCATAAAATTGATAATGCAGGGATCTTGCACATAATAT
ACCAATCAAATTGGATGTTGCTAATGCAGTAAAGATAAAATTAGGAGTTGCGAGTTGGAG
TTTTGGTAAAGGCTTCAAGGTCAGCATGGAGTTTACCATTGCAAATGGTGTTGCTCTGCT
CAGTTTATTCCAGTGTTTGCAGGTAAATGCAACTAGCAAAGCAACATGAAGAAAAAGTAT
TGATGTGGAAAATGATGTAGACTCAAAAATGCTGCGTGGAATGAATCTCCAGTTTACTGT
CCACTTATAATCGAATGCTCTGCCAAAATCAAAGGCTTGAGTCCAATACGACCAAAAATA
GGCAAGGAAGGGAATAGAAAATAAAATTTGTACAATTATAATAACAAAAATATGCATCCA
GGTCTTTTTGGGCCCCAAGATTTGGAGCAAAAGAACTAAATAAGCTGGGACATAAAGCAA
GGAGGACATCTTGACAGAACAAGCGACACTTAGTAGAATTGAAGCTCTAACCCACTTTTT
TTTGCATGAAGACAAAATAAAAAGGGAAGAGAATAAACTGTTGAATCCATCGTTAAATAA
ACGTAAGATAAATATACTGTGTAGACGTTTTGAAAGTATAAGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved