Locus cpc2
snOPY snoRNA Orthological Gene Database
cpc2
cpc2
I
snoU24b
1900..1983
3591
CTAATTTTGCAAATGTGTCGTTCCAATAAAAATATAGGCTAACCCCCTTGATAAAAGAA
AATAATCATGTGTTTAACGCTTTCTGACCTCAAGCGTTTTAATTGCAAATTTAGGAATTT
TTTTATAAACAAAAAAAAAATTTAATACACTGAGTGATCTAGAGCATTATTCAAGATAAA
TTTCAAAATAATAATCGATAAAATGAATAATAATTCATTTGCTAAAATCAAAGCAGGTAA
GATTTGTTTATGCGATTTTTAAATTGCAGAAAAAAAAATACAATAAAACACTTTCTGGTT
TCAGACAAGGAAATTTTTAAGTCACTATATTTAACCTAGAGAAATTATTAGACCCCAAAA
CAATTAGAGCAAAATTATTCAGTCATCAAAATACTATTTACAACGAATCATCAAGTTGAA
ATTATTAGCCCTGACAGGAAAAACTGTATATTTACGACAAACGTTTCTTAAGGACCAAAC
CTGCTTATAGTGTTTAGTCGGAAATGAAATACCATACTTTCATATACGGTAATACGAATA
CAATCTACAAATCACAAAGGATATTGAAAGGATAGGGCTAAGGACCCCATGTAAAGCTTC
ATTTTATGCGACTGATTGATTTAATTTTAGCCGAGTTTTAGGAATTCAAACAAAACTCAA
GCCAATTGCTCAGGCCAGTCATAAATCTCCTACTAGGTGGAGGGTTTGATTCTTCGCGCT
TGTTAGTAAGATAAGATTCTATGAATATAAAATTCATTTTTATTAATGAAAACAAGCAAA
TTTACTATGAAGGCTTTACGTTTCGTTACTATTGGTAGTAGTCACATTTTTGAGTTGCAC
GAGCGAAGCATCTTTGGTCTTCAAATACTCGAAAATGCCGAAACAACAATCTTCCAAGGA
CAACAATAGAAATACCAGAATGATTATTACATTAGAAAATATAACAGCATATTTATTCTA
TCGGGTATACTTCGATAGTCACCACCACAAGAGAACTGCAGCCCTAACCTAAAAAAGTTC
AAAGACAGTCACAGTCCATATAGAACATTTTTTGAGCTACCTACATCTCTCCTTCAAGAC
ATCCCGACCAGTCAACATGCCAGAACAACTTGTGCTCCGTGCAACTCTCGAAGGTCACTC
TGGATGGGTTACATCTCTTTCTACTGCCCCCGAGAACCCTGATATTCTTCTTTCCGGTTC
TCGTGACAAGTCCATCATTTTGGTATGTAAATCAAAAAAATTTCAGTGCGGTAATTGTTA
GCAATCTAATAATGAAGTTGTGCAATATGTAAATTATACAGTGATAGCGGTAGAAAAACC
AGACCTGAAAATTTTACCTAATTAGCACATCAGATAAAAATATTGAGCGCTTTCGATTGC
TTTCTTGCTTTAGTACTAGTTTTCTAACATCTATTTCAGTGGAACTTGGTCCGTGATGAC
GTGAATTATGGAGTCGCACAGAGACGTTTGACCGGCCACAGCCACTTCGTTTCTGACTGT
GCCCTTTCCTTCGATAGTCACTATGCCTTGTCTGCCTCTTGGGATAAGACCATCCGTTTG
TGGGATCTTGAGAAGGGTGAGTGCACTCACCAATTCGTTGGCCACACCAGCGATGTCTTA
TCTGTCTCCATTTCTCCTGACAACCGCCAGGTTGTTTCTGGTTCCCGTGACAAGACCATT
AAGATTTGGAACATTATTGGTAACTGCAAGTACACTATCACCGATGGTGGTCACTCTGAC
TGGGTTTCTTGTGTGCGCTTCTCTCCTAACCCCGATAACCTTACCTTCGTCTCTGCTGGT
TGGGACAAGGCCGTTAAGGTAAGTATTATTTTAGTGTATTATTGCAATACATAGTCATTA
GATGTTTATGGTTATTGGCTCTGCAGTTTTTAGTCAAGCAAGGAATGATGTTTAGATTAA
TATTTGCTACTTCGGAGGCCTTACGGCTCGATGAGACAAAACAAATCACCATATGTTCTG
ACTTTTCCAATTGTTATTTTGATTTTGGCTCTGGCTATAACCATTTACAAATTTATTCAT
TCTAATTAATTAATGCTAACTCTCTTCAAAGGTTTGGGATTTGGAAACCTTCTCCCTTCG
CACTTCTCACTATGGCCATACTGGTTACGTATCTGCAGTCACCATCTCCCCTGATGGATC
TCTTTGTGCTTCCGGTGGAAGAGACGGTACCTTGATGCTTTGGGATCTTAACGAGTCTAC
CCACCTCTACTCTTTGGAAGCCAAGGCTAACATTAATGCCCTTGTTTTCTCCCCTAACCG
TTACTGGCTTTGTGCCGCCACTGGTTCTTCCATTCGTATCTTCGATTTGGAGACTCAAGA
GAAGGTTGATGAACTTACTGTTGACTTTGTTGGTGTTGGCAAGAAGAGCTCTGAGCCTGA
GTGTATTTCTCTTACCTGGTCTCCTGATGGCCAAACTTTGTTCTCTGGCTGGACTGATAA
TCTCATTCGTGTCTGGCAAGTTACCAAGTAAAAATAAGATTTTAATTGTTGTCCCATAAG
ACGATAATGATGAATGGCTTTAGGGTGCATCGTTTTCTTTAAACTCTGAATCAAATTCGA
TTCCCAAAGAATATATATTAGCGGTTTTTGTGTCAATAAGTTTTCCGTCATTTTATATTT
TTAAGTAGATATCATATTTGAAAGCCATGTATTATGTATACAATTACAGAGTAGCACTTA
GCCTTAAAACAAAAATATTGCAGCAAAAATCCCTTTAAACACCAATTCAAGTTATGTGCA
TTGTTTTCGTAGTTTGCTAGTGACATAGTATTTTGGAAAGTTGGTATATAATGGTTTTGT
TTTTAACCTTTTGTACAAAAATGTATGTTTTGATGAGTAGAGTGTTAATATTTGGAAATC
CGATATAATAAAGATGCGTTATATCGGCCTTTCGCTCGTCCTTCGCTGGGGTGGCTGAAT
AGTTGTTGTTCGAGTATTCTGAATTATTTAAGAGGCATTCAATGAATAAAAACAGAATTG
TTTTTGTTTTTCACTAACGTTGGTTATAAGGATACTTGTTCTCTAAATGTGTTCAGGGTG
CTTAATTTTGTAATATATAAAATTTCAAAAATTTCGTACATAGGTAAACTAAATTAGTCC
TTAAAAAGTAATATAAATTCTACAGAAAAACTCTGAAGAAGCATTAGGTGAAAGGAAATA
GCAATCGCATCAAAAAAAATGTGAAAACTAATGCTAGGTTGATTAATCATTTTGCTATTT
GTAATTTGGTAGACTTTTGCCAAACAATTGAATCAAATTGGCTCTGGGTTCTAGATAACA
ATTTGAATAACTATACGCAAGCTAAAAAAGAAATAAAATTTCCAAAGTATGAAACCATGT
TTAAACCATAAACTATTTTACAAATATGATATTTTTACCTCTTGTTTAACTTTACAAATT
TTAAATCCAGGTAGTAATACTTGACATGCTACGAAATTTATTAGTTTGACTTAACTAGTA
AGCTAAATTAATATATAAACTACAAAATAATAAGTATGTCAACCAAGTCCCGTTTAGCTC
AATCGGCTTAGAGCGTCCGGCTTTTAACCGGAAGGTTGCGAGTTCGAGTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1221, 1419..1817, 2071..2591
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved