Locus Mono:snR98
snOPY snoRNA Orthological Gene Database
Mono:snR98
Mono:snR98
I
snR98
1001..1212
2211
GATAGTTTAAAAGTCCATACAAAGAATCAATTACCGTTAAACTTTTCTTAATGAGATTT
TCTACTTTCTCATAACTCAACAAGGTTGAGAAGTAAATTGTTAAGAAATTATAAGATTCT
TCAGGTTTTGAAAGATAAGCCAAGGAATTATCAGATGCGTTTATATTTAATTGAAGGACA
TTGATTTTTTGAAAATTTTTAAGGGTCGAATGGATAGTTGATTGAAGAGACTGTATGTCA
GCTATGTTTACATTATCGACAGTCCATTCGTGGGCTGCCATGGCTTCAGTCAAGATGCGA
ATCATGTTATTTAATTCCATTCTCGTGTCTTTTAAATCTTGAACGGTAAGTTTTCTTTTT
TCCAACGAATATTGTAAGACAGAATTACATCGCATGTTTAACAATGGCCTTCTAAAAGAG
TTACGCTTCATCAGCAGACGTTTCAGATCAGCAGGTTGTCCTTTGGTATAGATGTCACGT
GTAATGTTATTCATTTTTTCTTTTACGATGGTAATACAAACGCCGTGTGATGGTTATATG
TTGCTTCAATGTTTGTATTGATGTATAGAGGAGTCGCGTTAATTGTAAAAGATTGGCAGG
TGTTTGGCGGTACGCCAAACAGTAGCAACATCTCAAAGCTACTCCCCACCAATAAACATT
CAACTAGTTAGCAGTTATAAGTTAGATCAAAGAAATGGCCTGAAATTACAGATTTTAAGA
TCCAATCTCCGTCTTTTTTTATGAAGCAGCTACACCAAATCTATCAATGAATTTCAAGAC
GATATCTTATGGTAGCTAATAAGTCTTAATACAAATTACTCCAAATCATATTTTTTACTA
ATTATATTCTGCTTAATACAGCAATTCGTAAAATTGAAACAAATTGCGAAGCAATTAGAA
AACTATCTTAAACCAGCCTAATGAAAACTAGTGAAATACGGTAGTTCAGGAATTTTTATT
CATATATATATCTCTTCCATTTAGAAATTTTATCTTTTTCTATGCCACATACATAGCACG
ATTGGAGGCTTTGGAATTTGAGTCTCGGTGAATCAAAGTTCTTTGGTCTTGTGAATCCAC
GTGCAACTAAAAGGAGTGCTAACAGTGACTTTTGGTACGCTGTGTATATGCAGAAAAAGA
TATTAGACACCAATTAAGCCGGGACGAAAGCCTAATTGGATTGCTTTCGTCTGACTATGC
GTGTTTTACATTCATACCAAATTAAATAATTTAGCTAAAATATATAGAAAGTTACCAGAT
GATGAGAAGGCCTTTTGAAATAACAATTTGCTTACTGAAAACTTATACGTTAGACTTTTT
AAAGCCATGAATACAACAGAGTTAAGTAAATTCATTGTTTGCTATACCAATTTTGAAATT
TATTATTAATATTATTGTGTTTGCTGATATATTTGCGGATATTCAATTTTTAAATGCAAC
GGGAATTGACAACACCAACACAGTAAAAACTAAGTAGGAAATAAAACATTTATACAAATA
ATGAATGAAAAAAAAAGCGCCGACATAATTTTCATTGTAAGAAATAAGATAATCATTTCG
TTTCAACCATCTTCTTTAATGCTTCAGTAGAGAAAGACTTAGGACGCTCAATAGGTAGTC
CCAAAGCTCGATCCCAGATGAGTTGAGAGGCAACACCGAGTGTTCGAGAAACACCGAACA
AAACGGTGTAGAAGCTTTGTTCTTTCAAGCCATAATATTGCAAAAGAACACCAGAATGTG
AGTCAACGTTGGGATATGGATTTTTGGTTTTTCCATGCTCTGTAAGAACACCTGGAACTA
TTTCATACAGACGGCTTACAAGTTGAAACATGGGATCTTTAGGAAGATGCTCAAGTGCAA
ATTCACGCTGAGCCGTATAGCGAGGATCTGTCTTACGAAGTACGGCATGACCATAACCAG
GAACAACACGACCAGAATTCAAAAGCTTCCAGAGATAAGACTTGATTGTTTCTTCAGATA
AATCATCACCGATTTCTTTCTTCATTGTAATCAAAAAGTTCAAAACTTCTTGGTTGGCAA
GACCATGAAGGGGACCAGCAAGTCCATTTAAGGAGGCAGCCATCGACAAAAAGGGTGAAG
AAAGAGCAGAACCTACCAAATGACCGGTGTGAGCAGATACATTACCACCTTCGTGGTCAG
CATGGATGGTCAAATAAAGACGCATAAGCTCCACAAATTCCTCATTGTTAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved