Locus rlp7
snOPY snoRNA Orthological Gene Database
rlp7
rlp7
I
snoR39a
1213..1289
3138
GCTCGCGCTGCTTTCCAAAAGAAGCGTGCTGAAGAGGCCGAGGCTAAGAAGAAGTAAAA
TGTCTGTAGTTAATGGATCAGGCAGAACTGGAGTATAAATATTTTGTTTGAATTTGGGTA
ACTTAAGCTTTTTATGTACATTCGCAAACAGTATTGTATCCAGTAGCAGAAGTGGAAGCT
AGTTCACTTAAAAAATTTTAAGTAGTTTCACTAAAATTCCTATTTGCATATAACATTGGT
GGCTGTTTAAGAGCGTGGTAAATATTGTAGTCTCTTGAGTTTGTAAGTCGTACAGTCGTA
TTGATAGAATAACCTTGTAATTTCATTTTGAATTGCAAGGGCTTTCATGCATTTTCTTAC
AGTATATGTAAATTTGTGTTTATCAATTGTTTCCTTTTAATAATTGCTTTCTGATTTTTA
TAAATGTATATGATTATTTTACATAAATTGCGTGTGGAAAACTATATTTCATCAATGTCA
CATTTTTTTTTTCAGTTTAGGATGAATGACATTTAAACGGCTACCCTAAGAAGTTAAGGG
CTAATAATACAATTATTCAACTTCTCATGTGTTTTCGCACTGTTTCGATTAATGTTGTGC
AAAATTTATCATCTCCATATCCCACGTCCCTGAGGAGTTTGAGCACCAGGTGATTACATT
CAACATTGATAATATTCCTATTAAAATCGTTTGTATATCTTTTAAACATGAATTTCAATG
GTACAAGGTCAATTAGATAAAGTTTGGTCTTGGTTATTAGAAAGAGATGCTTCGATATGG
AAGGAGCAATCTACTATTGTGCAATTTTTGTTATATTGTCAAATTAAATTTGCCATAGTT
TTTAAACACCATTTTTTACCTTTAAGTACACATTTCAAAGCCTATTTGAAAATCGCTTCA
AAATTTTTTTGCGCTTATTAGCGGATTGTAACGAAGAACATTATGTGTCTTAAAGCAGTC
ACATTTCATAGCTATAATTTTTCGTCTGTCTATAGTCCCAACGTGCCCTCTACTCGTTAC
TAACAGACGATAAAATGGCGGAGGATGCACCGGTTGTACAACAGACTATGCTTGAACCTG
AGGTGCTTTTAAAAAAGCGCAAGGTCAATGAGCGTACTCGGAAAGAACGTGTTGAGCAGG
CTATTGCCAAAAAAGAGGTATGTGAATTGCTTGTTCTACAGGTTTGAAATATCCATAATA
TACATATTTATATGAAAAAGATGAACCTTTCACTCTTGGATTGCTAGTTTCGACGATGCT
GCTCCAAAATACCATCTTTCGGCTGATTCATATATTTTGTATTGGTTAAATTTAAACCTT
TGACTTCATCAATTTTTATATATTGTTAAAAACATTTTACTAATTTTACTCCAGGCCCAG
AAGAAAAATCGTAAAGAAACCTTCAAAAGGGCTGAGACTTTTATTAATAACTACCGCCAA
CGAGAAAGAGAACGGATTAGGTTAAATCGATCTGCGAAAAATAAAGGAGACATTTTCGTG
CCTGATGAAACAAAACTTCTTTTCGTTATTCGAATTGCCGGAGTCAAGAATATGCCTCCT
AAAATTCGCAAAGTTCTGCGCTTATTACGCCTTTCTCGAATTAACAATGCCGTTTTTGTG
CGAAATAATAAAGCCGTTGCTCAAATGCTTCGAATCGTCGAACCTTATGTTATGTATGGT
ATTCCCAATTTACATTCTGTTCGTGAACTCATTTATAAACGTGGCTTTGGTAAGATCAAT
GGTCAGCGTATTGCTCTCTCTGATAATGCATTAATTGAGGAGGCCTTGGGCAAATATGAT
GTTATTTCCATTGAAGATATCATTCATGAAATTTACAATGTAGGCTCTCATTTTAAGGAA
GTTACTAAATTCTTATGGCCATTCACTTTGACTCCAGTTAAACACAGTTTGATGGAGAAA
AAGGTCAAACATTTTAATGAGGGTCGAAAGGCTGGCTATTGTGGAGAAGAAATTAACGAA
TTGATTAAGAAACAAGTTTAAAACTTTCTTTGAGTTCGTGTAATGACTTAAATTTTGCAT
TCAGATGAAAATGCAAAAATGTATATTAGACTTTTTATAGGCCGTGGATTGGAATTTAAT
TAATTGGGTTACATTATTCACTATCTTATTGATTTATTAGAACTACTATGTAACGTATCG
TATGATGAGGGTAATTTTGTAGTTAAAAAAAACTAAATTATTGATAAATATTGTACATTA
TATAATATGAGTGCTGTGTTTTATGAGGTTGTCACAAGCACCTGTAAATGTTCATAATTT
TACACACCATAGCAAAGAAGGATTTTCCTAGTCTTCCTGAGAGAAAATGCCATGATAACT
TTGTTCAGCTTGCGTTGGTCCAAATTCGGCATCATCGTTCACATCATTATTAAAAGCAGC
AAGCTCGGATTCATTAGGAATACCATCTAAGAACAATGATTGACCAGCATCGTTTGTGGT
TGATGGCTCCTTAATGCCATTAGTTTCGTCGCTTCGGTCAAGCGCAGAATTAAACATTCT
GGATGAGTCACTTTGCTATAAAGTTAATGTTAATAAATTATTGTACTTAGTACTAAAGCC
GAATTACATACATCAGTTTGCCATCCAATAGATCCAGGGGGATTATGTGCTACAGCAGTC
AATGAGTTGTTGCGCTCTACTGAATTGAACAGAGAAGCTGGTGTTGAACTGTGCTGCCAT
CTATTTCCCATCATAGATGACACCTCTTGTTCATCTGATCCAACTACAGTTGCAAGAATG
AACTGCGCTTCAATTTCGGAATTTTTCCCTTTTGCAAAAGTTAAAAGTATCGGTTTTCCT
GGGACACCGTAATATGCACAAATCGAGCTTCCCAATGCCTCTGCTAAAATGACGGCAGCA
CGAAATTCACGTAGAGAAAGGGTAACAGAGACTCCCTCATTAAGTGCGACGCGTTCAAAT
TCTTTACCATCAATGGAAACAGTTGTTTGGGTAGGTTGCTTCAAAATATCTCTATTATGT
ACGACCTCTTCTGTGAAACTTGTAAGTAAAACACGTTCTTGAAGTGGTTGAATTGTAAGC
TCTTCCGTTCTCTGACCAAAATGTTCAGTCAAATCTTTTAGAATTTTTGAGTTTATTTGA
AAATTATTGTGACTAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1156, 1374..2138
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved