Locus Mono:snR88
snOPY snoRNA Orthological Gene Database
Mono:snR88
Mono:snR88
I
snR88
1001..1085
2084
AAATGATAGTGTTTTTAACTTCAAAAACAGTACAAAGAATGCTATAGAAAACAAAATGC
ATTTTCGATGAATTGAATTATTCATTTTCTGTAAACAACAAAAAGTTGGTTGAGAATTAT
GGAATTCGTTATTTTTATTTACCGTATTTCAATAGTTCGTAAATATGCATGACCGCATCG
GTAAGCATAGGCAGGCTTAGTAACTTGCATTTCTCTTTGTCTTTAAGCAAACATCGACTA
AAATACATATTGCTTGAAAAATTTAATATTGGTTGCATACACTTAATTCACAATGGATAA
AACAAAAATGTTTAGTGCCATTAATTTGGGCGTAGGTGGTATCTTCGTTTTAAGCGGATT
TATCAAGTTATTTTCATTTAGCTTCGTAAACGCTTTACTTGCATTGTTCATCATCGTTTT
CGGTTTGGGAACTATTGGTTTAGAAAAGGAAATTCCTCCTATTGCTATTAAATATGGATC
GTTCATGTTCTCATTCTTAGGAAGGGGCTTCTTCTACGCTTTCATGGGTACTTTACTCTT
TTCTTACTCCGGGTTTACTTCTTTCCTAGGCTTTTTAGTTCTTCTTGCAGGTATCGCCTA
CTGTGGTGCAAACTACGTAGCAGGATTGCAAGACTACGCTCCCAGAAGCATGCGTGATAA
TGATTGGGATGATAACGTTGATGAAGTGTAGACTTTTTTTTATTTCTAACTATATTATTT
GATTCGGTTCTTGTTCCTACCCCCCTCTTTTCCCGATGTCCTCCTACATATGATTTATTC
TGGATACATTCGTTTTCTTCAGGGTAGGTGTTCTAAAAGACAGTCACTTTAGCAGTCATC
CTCAGAGTAGTTAATGAGTATAAATATGTATACGATCTCTTAACTATGTATAATTTTTGT
ATATCAACATTAGCGTAGTAGCTATGGTATTTGTGATGGGTTTTAGGGTTATACATTCAA
ATACCTTTAATTGTCCAGCTTGGATTCTGAACTGTCGGGTGTATCGAGGAGGATAAAAAT
GACATGTCAAGCTCAACAATATGAAAAATTATGATTTTTTTCTATTTCTTCACTTTCTGA
GATGTATCTTGCAGTTCAAAATGTTAGTTGGCTTTACTAAAATTCTATTTTATTTCATTA
CTCTAATCAATTATCTTTTTGCTTTATGACCATTACCGCTTATACTCTATAGATGTTTTA
TATTTTTTATATCTAAATAAATATCTTAATTTTTTTGAGCTGTTGGGAATAATGAATATT
CTTTCTGAGTTTCTTACTTACAGGTCTTATAGACGTGTTTCCATTGTCCATACTATAAAA
TTGTTGACCTCTATAGTCACCGTTGCTTTTGTCACTACATTGCAAGAGCTGACGAGTCCT
CCAAATTGACAAATGCGATCCTCAATATTCCACTCAAGGCCGCTGGTTTTTTTAACATAC
ACACTCTGTCCTACTGGCAGAAGACCGCAATGTAAACCAATGTTGTCGTGACAATCAACA
TGATTTATTCCGGGTTGAAGCAAAGTTGATACATTCAATTCAGTTAATAGAAATACTTCA
TTCTTTTCAGAAATCGAGGCGGCCCAGAATAGATGGTTTAAATTACCAATGGCATGATCA
ACTCTTCCACCCATGCCACATAATACAAAAATAGTATCAATCCCATGTTCTTTAATTATT
TTATGGCATTTCATAAAGTCAGTGGTGTTTTGGCATGGGTCGAATACAATGTTGACTCCC
ATTTCTTTATAATAAGCTTTAGTTTCATCTGTTAACGAATCAAAGTCACCAACGACATAA
TCCGGTTTGAGCGAAGAATCGTAATTTCTCAATTGGTTAGCACCACCGTCTGCGCAGACT
CGGATACTAGCTCTTTTCCATAAAGTACGAAATCTATCATCCGGTATATCTATGGGTTGA
TTTAATAGTAATACCGCAAACTTTTGATCAGTATCATAGTCACGTAACCAAGCCTTACAT
GGAGCTAGCTGATGAGTGGCTTTTTGGGGTTTTGCAGGAACACACGTTTCAGCTTTCTTT
GAAGTATCTTCAAAAGAATCCCCTCTTTCATATTTTCCAACAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved