Locus Mono:snoZ16
snOPY snoRNA Orthological Gene Database
Mono:snoZ16
Mono:snoZ16
I
snoZ16
1001..1084
2083
AGAAGTAAACTAAGTTCAACACTTTGGATTCAAGGAAGGTAGTAAAGGGACTATCATAA
ATAGATCAAGTTGGCGCTGTGTCCTTTCAACATTCTCAACTTTCTGACCTAAGGCAGCCA
TTGAAATGCATTCTCCCATTTAGCGTATCATACTTTTGATAAATTAACTGAAGATAACGT
CGCCAGTATACTATTATTTTAGACATTATATTACACAATTCATAAATAATGATATTCAGT
GTAGTCGTTATGAATGAGGGATTCTGTCAATAACTTTTTTATTACAAGGTGATATGCTAC
TACAGCTCCGATAACACTTAAGAACATTGCTCATTGATATACTGAAAGTATTAAATGCTA
TGTCGGTCAATTGCTCGTCGAAGAATCGCAGAGCAACAGATCTATTCAATCCAAAAACAG
GTTAGGGTTATAAACAGTCACGTAAATAGTCAGTAATATATATACCACTGTTTCCACTTT
AATTTTTCCAAATGATACCTTTGAGCTCGAACGATCGTGGTTGAAGCAGTCATACAGGAA
TTTTTATTCCTCTAAACAGCTTTAGGGAAAGTCCCCGGACTCTTGCGTCTTGATCTCCAT
GGAGATTGGGACAGGCGGTAACGTGCTGACTTGAAGAATCAGCGGTTTCATTAATGGCGC
TAGTTTTTCCTTTAGCCTTTGTACTTTAAACCTCAAGAGATATAACTCCTTGTCCAGAAT
GGAGTAGATAAGGAATACAGTCTATGAGTTGTGTTTCTTGAGCGTCTAGTGTACGAACGG
TATGGTTGATTACGCCATTTCTGAATTGTGGTTTTTCGTCGTAGTTGATAGTTATACGGT
CGCATCCATTTGTTGATGTATCACAATGGGGCTTAGTCTCGTGCTCAAAGGTTTTTTTCC
TTAAAGAAAAAGGTTTGAAAATTTGGTTTACTCTGTCGGAGTGCTTGTTCGAATCAAGCC
AGACCTACTTTTAGTTAGCATATTATTAAATGTAGCTTTTCCCAAAATATGATGATCGAC
AAATACAAAGAGTCAAGCACTGAAACGCGATAGCGTCTTGTTGAGTTATTTGGTCTGATT
TTGGTATTCATATAAGTTTTTTGTTTCTAGAGCTGTTTTACGTTATTTAATGAATTATGT
TTTCTTGTAATGAATTATAGGTGCTATGTAGCGTGATATCAAGTTTTGCTTTTTCTTATT
GAAAGTGTTAAGGTACGTTGGCATAGGCTCGTTAAAAACGAATGTTTGGGGTTCAGATAT
GTTATCCATGCATTAAATTTTCAGAGATAAGTCAAGCAAAAGAACTGCAAATTTAGCCGC
CATCAATGTTTTACTAATTGCGGTAGTAACAGTTTGGTTTAGTGATGGAAATAGCATAGG
TAGCATAATAACATAAGTCGCAGTAGCTCAGCTGTGTTATTGTTTACATTACTTGGTTGC
GAATTTTTGGCATCATTTATTGTTTGCGGGCTTTTTTCCTTCAAAATTAGATTGCTCGTA
ATCTCTTGACGATGGGATTTTATGATTTACCTCTCTCATTACTAATTTGATTTAATCCTA
CAACGCAGCATTTTTACTTTTTTTGCCAGCTGGTTCAAGCTGGATCTTTTGGCATATTGT
AAAGTGCTTAATTTCTGTTGAGGTTTCCCTATAACTATAATTTCTGATACTTGTTAGTGT
TATGCAAACATAGTTATTATTTTCCATGAACTATAATGCAAATGTTGTCAAGTTTCATTC
AACAATACTTCACAAATTCGCTCTGAAAATATCGAAATTTCTAATTTTATGCATGCGTCG
AAATAAGCGCCAATTGGCTTGTATGAAATGCCAATGTGAAAATCCAATGGCTGCGATTAC
ATATGCAGATATTGAATATCCTCACAATACGCATTTTCTACTTTTAGACTCAATTTCGTG
GATACCGTGTACATGTAAAATTCTCAAGTTAAAAGAATTCGAGCTGCCAGATCGCTTTGA
CATTCCAAATTTGTTTTATGATGGTTGGTTATCTTATGTTTTCCATACGTTTAGTGGTGT
CTATTTGAAAATTGGTTATGAAATGGATGAGAGCGGGTTTTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved