Locus Poly:snR41
snOPY snoRNA Orthological Gene Database
Poly:snR41
Poly:snR41
I
snR41, snR70, snR51b
1001..1087, 1227..1335, 1479..1563
2562
CTAAAACCCAGGTTAGCAAAAAAGATTCCTACATTATATCCAGCGATGTTATGTAAGTC
ATTAACTGAGTTCAATAAGGTTAAATATGATGAAGTTGGTAAATTTTTACAGTTGCTAAT
TGTTAATTTAGCTTTATTAAAAAGTAAAAAATCAGATCCTGACTCGATTCGACAAGTTTG
CATCGAGCAAAAGCTGAACGAGAAAACAGTACTAAATGGAGAATTTTTATCGTAAGTAAA
CGGAATTACTTTGACTACTTGATCACTTTTTTACTAATTTTATTTAGAAAATTTTCTTCC
AATATCAGCTTTCAATGGACTCCGGTTATGTCCGTTGTTGGCGGGGTTGTTTCACAAGAT
GCATTGAATTCAATTAGCAAGAAGCAGTTCCCCATTGATAATTTCTGGATTTTTGATGCC
GAATCAGGCCTTGCTCCAATTTATCGTTTGTAACACCACCTATGCCCAGATATTCTATAC
CGCAAGGGTATTCTGTTATTTAGCATCATTCTATGAAAAAAATTTGGAGAATTTGTCTTT
TGCGAAATTAAAAAAAATAAACCGCCCTTATCATGTTATTAATTGATACAATTATTTACA
ATAGTATTGCAAATAAAATTAAGTCTTATATTCAGCAATATCACTTACTTTATCCTATAT
TTATTATATCTATAACAGCTTTTTATCCTAAAATTGTCAAACGCTTCCTTTACTTCGAAT
GAAAAGACTAAGATACTCGACTGCCATTAAAAAAATAATAGTGAGACTTAAGCGATTTTA
TGGCAGAAATGTTGAATTCGTTAAAGACAGCAGTCACAATTTTGTATACTCAACTCTTAA
ATTGCAACCTCAGCTTCCTTGTATATATGGTTTGTAATTATGGTTACTTGTTAATAACAA
TCAAAGTTATTTAATTTAAAGATTGCTAATGTTCTTAAAATAGCTTATACAGGTAAGCAT
AATTTAAAAACAGAAGTTCCTGTAGCTTTACTACTAACAATCATTGTGATGATAAAACGA
CGAAAACAGCTGAATTCCTCATGTTGAATTCGTTATATTATTTTTTAAGTTTCAGCCTTG
TCTGATCATGATTTTTTTTACTTCTTTTTTCTTTATTTTTTTGTTATTTTTTCTGACGTT
TTTAGAGTTGAATCCTAATTTTTTAAAAAGTTGTATTTTAATATATTTCCCATAAGGTAA
GTTAAAAATTTTAGGTTGCTTTTCAAGTTTAAGGATGATACCTAAGACGCAACGGGCGGA
CTAAATGGGTTACTACAATGCTTCAACTGTACAATGAAGTTGTAACTCACATGTTGTTAT
CGTGTCTTACTGAAATACTTGATTAGCATTAAATTTTGTCTTTTTTTTTTTTGTTTGTAT
CTAAAGTATTAACTAAGATTTTAGATTTTACATAGTTACTATTGTGCTACATTTTTGGTT
CAGTAAATCTCAAATAGACCGTTTTAATAGATAGCAACTTGCCATGATGAGCCATTTTAT
ATTTTGTATTCACACTGTCTGAATTTCTTGAAGATATACTGAAACTCTGAGCAAAGCCTG
ATTATTCATTCGTTTCTTACATTTGGTAGTCAACAATATTGTTATATTCCTTCTCATAGT
TAATACGTCTATTTAAATCCAAGTATGCTACTAAGAAAATCCTGGATATAGTAACATAAG
ATCAAGTCGATACCATAATTTATAATTTGATACAAAGAAATATGATTTAAAGTACTTTGA
ATCTAAATATAAGAAGTTGATAACATATACAATTTTTATAGATATCGTATGACAAATCAC
TATGTTAACCTATTAATCTAAAACCAACAATCATTGCGATACTAAAACAGACTCATTTTG
ACAATTATAATAGTCAACATCTAACCACCAACCTTGACTAAAATAGACGTCTAAAACGCT
TCAGGTGATACCCCTTCATGAACAGCACCATTAGCTCCTCCATTTTCAACAGCTGTAATG
ATACCTGCACGAATAACCCAATCACCAAAGTGTTCACCATCTTCACGCTCCAAGGCGTAA
CGCTTGATAAGCGGACGCAACAAATTGAGGATTTCTTTTTCTTGAACGGAAGAGCGATAT
AGCTTGTTTAATCTCTGACCGTAAAATCCTCCACCAAGCATTAGATTGTAAGTATTTGGT
GCCTTACCGACACACGCAATTTCAGCAACCCATGGACGAGAGCATCCATTTGGACAACCA
GTCATACGCATAACAATACTATCTTTCTGAAGACCAGCTTCGTAAACAATTTCTTCTACT
TTCGTAATCAACTTGGGAAGATAACGTTCACTTTCAGCCATGGCTAAACCACAAGTAGGG
AGAGCAACGCAGGCTGCAGAAGAAAGACGTAAGCCAGAGAATGCATTATTATCAAGTTTA
TATTTGGCCATATGCTCATTAATCCAACCGAGCTCATTTTCAGCAACATTAAATAAGATG
ACATGCTGGTTGGCAGTCAAACGGAATTCAGCCTCAGATTTTTCAGTATATAGACGTTCT
GCGAGTTCACGCAAACCGGTCTTAAACTGTAAAATACCATTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved