Locus Mono:snu3
snOPY snoRNA Orthological Gene Database
Mono:snu3
Mono:snu3
I
snu3
1123..1379
2378
GGCTCCCAAATACCAACCAACGTGACCAGTAACAGCACCAATGTACTGAAGACGATTAA
GCATCGCCTCAGTATGAGCTTGGCGTGCTTTACCGGAAACAGACTTGTTAACAGCAGACT
CTTCATTTTCAAGAACAGACGGAGACTCGAAGCTGCTACTGACTTGTAAAACACCATCAA
TGTCAATACCAACAAGCTGACCTGAACGAAAGTTAGTTAAAAATATTATTTCAAGAGAGA
AACTGTGGTTGATAAGAAATTTCACTAAGTAGAGCATTACTGAGCTGACAAATGCATAGC
TGCATCTTTGATGCAGAAAAATTGCAAGTTTTATCATTTCGAAAAATAGGGAAAACTTAT
TCTCCAATGACTACACTTACCAATTGTTCCCATATTAGGAAAAGAATCACGGCAGTGCTT
GATGATATTCATTACAAGTAAAGATTCTAATTCCACCCGCTCAATAGGGGGAGACTCCAA
TTCTGGACTACTGAATTAGTTATTTATATATCTTAGTCATTCTTACACATTCAATGAAGT
TGTATCAGACATGTTTTTTAAGTCTGCCAAGTAGTTGGTTGAAGTGCAAATTGCTGTACG
AACTTCTAAAGGAGTTAGTGTTCACCAGTTTAATGACAAGTAACAACAAGTAGCAACTTT
TTAAAGCCATGGCTGTCGGCGATTACAAGTTATAGAATAGAGGAGCCTACCAGTTTTATT
AAACCTTTTCTAACTAGTTAAAAAATTTGTAAATTTTTTTTTTGTTTTCTCGGCCTTAAG
CTCTATTTTCATGACTTCTTTTACTAATTTACCGAAATATGATTTTCATGCTTATTGTAA
TTTAAGAGCAGCTTCACCGCCTTGCAAAGTCTTTTTAATATAGTGTAATTGACACTGCAT
TATACTTGAAAGTTCAACATTATTCGTTGATTGGAAATGAATGTGACTGCTTTTCCGTTA
TATTTACTATATATACGGGTCATTATCCTCAACAAAACACTATCGACGATACTCCATAGG
ATCATTTCTATAGTATACGTCCGGCTTGGGTTTCCTAACCTAGCCACAGAACTCAACACG
GATGATGATAGGAGGCACCGTTGCCCTCAGAGTGAGGACTTTTAATTCTTTGAAGGCATG
CTTTTCGATTAGGTTTTTTACCTAATTGTTTTGCTGTCTTTCTATGCGATGATCTCTTAC
ATGATATGTTTCCTTTTGGTCGTATTATGTAGGGCAGCTGGTGTTTTCTGACGTGTTTAA
TTTCATCTATTATATTACAACTGTGGTGTCGTTTGATGACATAGATGTAATTTCTAGATG
AAGTTGTGTCATGTTTTAGCGTAGATTTTAGTGAATAAATGAAACGATTTCAAATTCCGT
TAGATTGTTTGATTTATGTTTCTTATTAAAGGAGTCAATTGTATGGTATTTGGAGTTAGA
TGGATAGCTTACTTGGCGGCGTTTTTTATTTAATATTGTCTGCTGTACATTCGTTAGTAG
TAAAGTATTACACGAACGTTTCCACTCAATTGGAAAGTCAAGTCCATGCTTTGTGGGAGC
AACATTGATCATGTATGTTTATGTATTGCTAGTTTGTTTATAGAATAACGCAGATTACGG
AATCACGCTATTTAACGTCAAAACGTCAAGAAAGGTGTCAATTATGCTCGTTGTCATGCC
AACGTCATTGTTTGCGTTTTTTCTTTGATGATTACTTTGTTTATTGTTTTCAGTTGAAGA
TTGTAAAAATATCATTAGCTGAACGTTGCTTTAAAGGTGTCTTACGTGAATATATTAAGG
TTACTTTATAACGGCGTTGTATATTCATTTGTTACTTATTTACCGATCCTATGTTGATGC
CGTACTTGTTCCTTGTGTAGGAAAGCTGATACCTATGTACGTACGTATTGCTGTTAGGCG
GTTCTTTTATCCCACACCTCTTCCTAAGAATAGCTACAAACATTACCAACTTCATATTAA
TTCATCAATACGATCTTGAAACTTAGAAGTACTTCTAAATTGTCTTTTCTTGTCGATAGG
GCTCGTACATTTGAACTGTTCTTGCTGGATCGTTTCAGATCAAAGCTGATCATATTACAA
AGAACTCACGCCTTTACTAGCTGACAAGGTAGGATAACGTCGGAATCCATAGAGAATTTG
CAACTTATTAAACCTTAGAAGCTTCTTACCCTCTTAATACTATGGACAACGCTAATTGCG
TTGGCGGTTGCAAATTTGAAACTCGCAGCTTTCAATATAGAAGGCGTATTCCTTATAGCC
TCGGTGCGGATCCACTTCCGCCAGTACATCCTCTATCATTAAAGAATTTAGTTGATATTG
ATACTGATCTAATTTCTTCTCAACTGTACGAGTTGTATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved