Locus psf3-antisense-1
snOPY snoRNA Orthological Gene Database
psf3-antisense-1
psf3-antisense-1
I
snoZ8, snoZ7, snR75, snoZ4, snoZ3
1086..1164, 1297..1397, 1556..1629, 1747..1835, 1984..2074
3901
AGATTTCTGATATTGGAAATGATGCTATATCTACTACTCGTAAAACAGTTCGTGCTTTT
TTAGAGAACGCAAACCCTTATAGCACCAATAATGACGGGAATCCGTCAAACAACACTAGT
GACGTTGAAGTCAACGAGACTTCAATGAACGATAACTCTGAAGAACCAATCTCCTCAAAT
TGGTTAGTGGACTTGTTTCAAAAATCTTTGAAATCATTTCGCGAATAGTTTTGAAATGCC
TTCAAAAAATAATTATTCAAATCTGGAGCTTTTTATTTTATTGAAGTGATGTGACATCTG
ATTTATGGTAACAGCCAAGCGTTAACAGACCATTGTTTTTTTTCCAAAATTTTTTGACTT
TGCTTTCTTTTGAAAATTTTTCTTTCAAATGTAAATTAATACTTGTATGCAGTTGAGTTT
ATCTTGGTTTTCTAAATAGCGCATTGAATGTTGTATTACTTCCGCCGGTGATCCTTAATT
TACTTAATCAAGTCTTTACTATAACATACCCACTAATTCCAAAGTTAAATGAAAATCTAC
ATCTTTACACATTGTTCTTACGGGCCTTTATTTACAAAAGTGTTTTATATTTCGCAGTAA
GACCTTACTTTTTGATGGTGCGAAATCGTCTATCCGCTCTCATTTCTTTTTAGCATTCAT
ATGAATTCTATTAAAACAATCTTTATATTCGCTTTTCGTTGCAAGCGTTCATATTGGTGT
ACACCTTCATAAAATTCATCCTTTTAATAAAATCTGATTTTCTGTCACGAGCATTTAATT
TACTTTTCCAGAAACTGTCTGTATAGTTCGTGATTTTAGTAGTAAATACTAAGCATGCTA
GATTAAAATACATTTTTTTATATTATCAAAAAGGATTAAATGATAATGTATTGTACTGTA
TTACCTTATGCCAGTATACGGCGTTGTTAGTTGGGACTACTTTTTTGCTAAACAAAATTT
CTATATAAGCTGTGACTCTCTTGCATCTAAACCAAATTTTTACCAACTACAAAGCTTAGA
TTAAAATCCTAACTTGAGTATCTTTAATAAATGGTATGTGTCTATAACCACAGATGGAAT
CTCCTGATCTTTGATGACCATTTTTTAAAATACAAACTAGAGTTTCTGATTAATTTATGA
TTTCAAATTCTTGCTGAGTTTAGTTGTTTCCTTCTGTATTTTGGTTATTTCAACACTTAT
GCTAACATAATTTAGTTATGATACAGTTTAAACTTTGCAATAAATTTCTTTCTTAAAAGT
CAAATGTAAGTGTTTGAAAGAATTGTTTATGTTGTGTTGGAAAAGATGAAAAAAACTTTT
TTTTGGAATTACCGGCCTAGGAATAGTTTACTCCTATTCCGCTGAAGAATAAATGTGCTG
CAATTATGCTGATCCATTACAATATCACAACTTTTTTTATGGGATTTTCCTATTATTAAC
ATCATTAGTTAACTGAAGCAGTCTAGCATATTGATATTATAGTATTTAAATCATTTAATC
ATGGATTTAATACATACCTTTTAGTTTGTATGTGATATGAGAAAAATTGTTCTCAATGAG
GAATAATTAGATGACGAGTCTGATTCAATATGAAGAAAAGACTCTTAAAATTCCATTCAT
GCTAACTGAGAGAACAAATTTTTAACCTAAATCTATGCCAATATTTTACTAACATAATTA
TAGGTTATTCATGAAAGGTATCCAAAACTTAATTGAAAACTAGACTTCAAATATGTACTT
TAGGGTATTATTAGGATGATTTATTAAATTTCAAAGACAAGCATATGTCTGATGCCATTG
GTTTTGAAGAAGTGAAATGCGTCTGATTATAGACAACCTAAAGTTATATATTTCCATGTC
CTAAGTTTTCGTGTTAAAACAACTTTTCTAACGTATTTGCAAGACCTTAAACTAGTTAGA
TACACTGAAGTTAAGGAGGCTGTTTTGTATAGGTAAGTAGATCAGCTTGAGGTCGAATTT
TAGTTCACATGATGTTTTTACTTTAATCACGACGGTCTACGTAGTTTCTACATTGACGAA
GATTGCCTGTGACAAGGCGCTTTTTCTGAATGTACTTTATATATCGACCTCTAATTTTTA
GTGTCGGTTCGTTTATTAACATTTTTTAGTTCTATAGTTTGAATCTTCTAGAGTTTTTAT
AAAGTTAATCATAAATGAAAATGTCAATCTGACAAACAAAAGCTAATTTTGTAAGTAAAC
GTAATATTGAACAAGTATATGTTAAGGATTCTTTTCTTTTTTCTTTGAACAGAAGGGATT
TACGATCAACACTCATTTAGTGTTTCACATATAGATTAGCGTGCTATTCTGGGTAGCAAT
TTCGTCTCGCAGCATGCAATCAACTACGAAGTGGAATTTTGCCAGTTTATTAGGGATCGA
TGGGCATTATGTGATACTCTCAATACTGTGGCAGCACGAGCTTTTGTTAGCTACTGAATC
TTTTAAAGGCTAGAATGAACATACTGTGTTTCTCAAAGTCATCCAAACCCTCAATGAATT
GTGAGTTTTGTTGTAAAGCACCTTGAGGATTCAGGGACGCATCTGCAATCAGCATTGCTC
TGGAACGTAAAGTGTTTAGGGAAATTTGAACCAAGCTGTCGTCTGATATTCTACAATGAG
TTAGTAAGATTTTGAATTTGAGAAAAACGTGTAAAGTTTGACTTACAAATGGAGCATTTT
CTCGGCAAAATGGTAATAATGTGTGGTTATGTCCCGAATAGATACACTATTAGGATTCGC
CTTTAATGCATTTCGTACTACAGAAGAAAATGGTGCTGGCATATGAATACTAACAAAAGA
ACTATAAAGTAAGCAAATAAGCAAAATTATCCAATTTTCTATAAGACATTACATGTATAT
AATGTAACATGCAGAAAAAACCAAAAAAAAAAAAAAACTTTACTTACTTAATTGCTAAAA
CCTCTGCCAGCCAAAAAGGAAGTTCAACTTTAGAGCCCGTAGGAACCTAAACTGTTTAGA
AAGTCAAGTTCTATTTTTATAAACTTCACTAACCATACGCCCTTCATGGCCTAGTCCTGG
AATGGAAACTGTACTAGTACATGGAACCTTTTGATTTTCAGACAAGATACTATCAATATC
ATAGTAATCCATTTTTTTAATGTCTGAGCAGAAGGAATGATAGAAGTGTTATTGTTATTT
TATCAAAATATGTTCATTTAGAAAAGTTGCAGTTACAAGGTAAAAGTAGGTAGATGCAAC
GATAAATTCAAATTTGAGTTGGCTAAGATATAGTGGATAAATAATGAACTGTAATTACAC
CAGTACTAATCAACAAAAAAAATAGAGATAAAAAAGATTTATTTTTACTTTTCTTAACAG
AGCATCTAGTTCAAAAAATTAGTGCTGATAAATATTGTATGTTCGAGTACTAAAAATTTG
CTTCAATGTTTAACTCGAAAAGTATGTCATACATGTGTATATTCGTCCTTCTGAAATTGG
TCGAAAAATTTTATTAAAAAAAGGAAACTTTGTTCTATAGTTTCATTAAAGAAACGCATA
TGCTTGTTTGAATGTTATACCTATTTATGAAACTTGCTCATTATGCGATCAAAATTTACA
CAATCTTTCCGTAAAACTGATTTTTTTAAATGATTTTTAGTCCGTAATCTACAAAACATG
ATTGCATTGTATTCAAAATTATTTTGCGTATTAATTATTTAGTATGTCATTTCCAAATGC
AAAAAGGTTTTAACACCGACATAGGCCAAATTTCATAAGTTATTCGCCAAGTTTCATCAA
CAGGTTCATCAAGTCATATACGCTTTAATCCATACTTTAGATGTCAACACCTTCGAGTTT
ATCAGCAATCTTTACCTGAGTAAATAATCAACCTGCTGCCAAACAATGTTGTAAAATCAA
AG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 1215..1264, 1448..1526, 1683..1696, 1903..1951, 2129..2901
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved