Locus Mono:sno52
snOPY snoRNA Orthological Gene Database
Mono:sno52
Mono:sno52
I
sno52
1001..1096
2095
GCGGTGGTATTGCTGTTATTAAGGTTGGAGGCTCCAGTGAAGTTGAAGTCAACGAGAAG
AAAGACCGTATTGTTGATGCATTGAATGCTGTTAAGGCTGCTGTTTCCGAGGGTGTTCTC
CCAGGTGCTGGTACCTCTTTTGTTAAGGCTAGTCTTCGCTTAGGAGACATTCCTACAAAT
AACTTTGATCAAAAGCTTGGCGTCGAAATTGTTCGCAAAGCTATCACTCGTCCCGCTCAA
ACCATTCTTGAAAATGCTGGATTAGAGGGTAACTTGATTGTTGGTAAACTTAAGGAGCTT
TATGGCAAGGAATTTAACATCGGTTATGATATTGCTAAGGATCGTTTTGTTGATTTAAAT
GAAATTGGTGTTTTGGATCCCCTAAAGGTCGTACGTACCGGTTTAGTTGATGCTAGTGGA
GTCGCCTCATTAATGGGTACCACCGAATGTGCCATCGTCGATGCTCCTGAAGAGTCCAAG
GCCCCTGCTGGTCCTCCCGGAATGGGTGGCATGGGTGGAATGCCCGGTATGATGTAAGGT
ATCAAAAAAATGCCGACGTGGTTTTTTAAATTTTTACAATTTATTAAAAGCTTATGATTA
TGATGATTTAAATCCATTCAGAGAAATTGGCTTTAATTTTGCATTATGTTGTTGACCTTC
GTAAAATTCTTTAGTTTCAAAACTAGTTAATGGGTCATACTTCTGTTAATGGATACTTAT
TGTTTTGAAACTTTTCATTCGGCTATTCTCATATGGTTGCTAATTGTACAATCAAACTCC
TGATTTTGTTTAATGAACATAATGTTTTACCTTGTGTTTATTACACATTATAATTTCACT
CTTTTTACGAATGGTATGACTTTCGACTTAAATACCAAGTTTTCACTTTTGTGTTTTTGT
AAGTTCTGAATTGTGTTTACGTAAAGCATCAAGTTTCTTTATATTTCCTATACAGGTTTG
TGGTGAGCTTTGAAATGGTTGAAGTATGTGAGAGATAAATGATTTTGAAAATGATGAAAA
TAACGCGGATGAAATATATGTCCGAGAGCGCAAAAAATGTGTGGATATTTCCGTTGCCTT
CCTTCTGATTCAAAATTATTATATAACTTATATATTTTTAGCTGTCGTGCGAGTATCCCT
ACTATATTCTTTTTAGGGGATCTGTATAGGTCATATAAAGAAAATTAAAATGCATGATAT
TATGTTATCACTAGTATTGTGGTAAATTGTATTTTCAAAGTTATGATGAGAGGCAATTGT
AAGTAATAAAGAAACATTGGTGCGGTGTAAATTTTAAATGAGCCTAGTAGTTGAAGAAAG
CTCTCGACGAGCTCATGCCAATTTCACAGCCTTACATGAATTACTCCAGTTTTTGTAACA
TTTTAAGAAAAAGCGCGCCGTCACTGATGTTGTTGCCGTCTCTTTCACTTTTTTCTATTC
TATGTCGTACCATATATAAAAGATACAGTGTACAGTAATGTACAATATGAGCTGAATTTA
AAAATGTTGTATACTTTTTTGCTCCATACACTGATTTCGTAGCAAATAAACAAATAAACA
GGTACCTTATAACTGTAAACGATTTATTACCCACGCCCTGCTTTCGCAAGTTAAATAGGA
AGTTCTGGAGGAACAAAATCATATAAATAAAACCATAATCATCTGCTGCAAAGATTCGTG
AGCGCTTCAAAAATATTTACATATATCTAAATCATCAGCACTTCCCCGGCATTAGTAACA
ACTTTAAAAGGAAAATAAATTTATTCAGACTTCACAGAGAAGTCAAGTTTATCCTCCTCC
ATTCGTGAATCCGAGGAGTTCTCTTCCTTTGGTTGATTCTGTTGGGTTTCATTACTGACA
ATCCAGTTGGGTTGAGTTAAACAGTACTTCTCCGGTGGAAGACGAAACCCATAAGACGGC
TGAATTTGGGGTAAAGGTTTTCGATTTCTCTCCATAGCAAGCTCTAGTAAAAATTCTTTT
GGTGGAGGTCCAGTGAAGGAGTGATTGATTTGAGAAGCAACAGCTAAACGTACATCTTCT
ACAGAAATTGGAGCATTTTGCCCACGTGAATGTTCCGCATAAACCTGTGAATCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved