Locus rad8-antisense-1
snOPY snoRNA Orthological Gene Database
rad8-antisense-1
rad8-antisense-1
I
snR97
1473..1621
6237
GTATTAGTAATTAAGGTCTTTTGCAAGTTCTCAGGTTTCAAAAAGGAGTCTTGAAGGGA
AAGATGGGTATTAGTAATAATTGCATCCTGATCCAACAACCAGATCCATTCCGCTTTGGG
GTATTTCTTCATAGTTTGTAAGACGGCGGGCATCTTGGACCAAACGGCGGGAATAGGGAG
GCCAGTAACATTGACATACTCAAAGTTGTAGTTTTGTTTGGTACTATAGTCAACTCTGTT
CTGTATAGCTTCTTCAAACGTATTAGCTCCATTATTGTAAGAAGTGTGTCCATCACTAAC
TAGTAATAAGACAATATTTTGACTGGCAGGATTTTGCTGAGGCTCTGACTCGTATGACGC
CTCGTGGAATGTAGTGCTTGTGGCCACCAAATGAGAGTCTAACGGCGCCAACTCAAACGA
GTGATTAACGGATGGAGTGCCAATAGCATCGGAGAGCATGGGTGCAATTTGCTGATCATA
CAACTGGTTAACCTTCGACACCAAATCAACGTCCACAAAATATATCAACGAGTATAGAAA
CGCGCCAGCAATCAAGCCGACCGTTAAAAATAAGAAAAAAAAACGACGTGGAATCCTGGA
TAACATAAGTGCCATCTTTAGGTTATAACAATTCTTCAGTAAATCAATTAGAAATAATGA
AACAATAACTGGAAAACTTTTTTTGAAAAAAAGGCTTTTCCGAAATCTTAAACAACCACT
AAATCAGATTGTATTAAGGTCTTATCGAAACGACCTATAAAATAACGAACGAAATCTCGA
GATATAAAAATAAATCAAAGGGTTAGAGGTATATGCTGATGGTAAAAAAAAGCTTCCTGA
TTGTCTTAATGAGGCTGAATACGCGTTAAGCTTCCTTTGACTAGCTATCGTTAATTTTTT
AAAGGCTTTGTTAAATATTTTATTAACGTCGGCTCCTTTGCCGATGGTAGAGACAACCGT
AACCTTGCCTAAATTTTTATAACCCAGCAACCGGCACGTTACTTGCTTATAAAACTTTCT
ACGGGTAGCTATTAGAAAAATGAAATTTATGGAATGAAAACTTAGCTAAAATATTCGGAT
TTAATTTTGTGTCACTGATTTCATCAAAATATCTTGACCTTATTAAACAACTACTTCGAC
TTTTCAACAAAGAGAGAGGCTGACCAATATAGTTGAATTATACACATCGCTTTCTTTCTG
TGACCGGATTTCCATCACAATCGCTACTACTATTTAACAAGGTTAACAATAATAAAAAAA
TCGAATAAAAGTTAACAATTATACCTATCTCTAATATACTGAACAAAACATTAGCCAGCC
TTTACACTGCAGCAGCTAAAACTTATATTCCCTTGCCCATGATACTCAGCAACAACATCA
TGAATACAAAAAAGTAAGTCATCCAAGGAAATTTATGAGTTCAAAAAATGGAATAAAGTA
TTACACATTCACTACTTTAGATTGTATAGCTCCAGGGTAAACTGTCGTTCCTTAATACTT
TTGTTACTTATGCACCGAATTCGACTATTTCGCATTCATTAGTGATAGACGTGAATCAAC
AAATCCAAGGGGTGTAGATAGTTTATAATTTATCTTGTAACGCAGTTTGTTTATCACATA
CTCTCTTAGAATTTGACAGTCATGACAACGACCACGGTAGCAATTGCATTTCATATGCAT
AATATGAAAATACTTTTTTTTTACGATAGCTTTTAATCGGCTTGGTGAAACCGTTGTTAA
TATTCAAACAACATTTTGATGTCTTCAATTGACTGAACCTGCTGCTTTCCTTCCGACATG
CCCAGGGTCCCAGTAATAAAATTTTTGCGTTCTTGTATTTTGAGCATCCTTTCCTCAACA
GTATCACGTACAATATATCTCGTCACAAATACAGGCTTTTCCTGTCCTAAACGATGAATA
CGATCGATGGCCTGTGCTTCCACTGACCAGCTCCACCATGGATCCATAATAAAAACATGG
TTGGCACAAGTAAGGTTTAAACCAACCCCGCCTGCCTTTAAAGAGATAATCAGCACGTTA
ACATCAGGATCATTTCGAAATGTCTCTAAAGCCGTCGACCTCATTTGTTGTGACATGGTA
CCATCGAATCTAGCATACCCCATCTTCTCTGACTCGAGAACGTCTGCGATAATATCCAGG
AATGTGGTAAACTGTGAAAAGATAACGACCTTTTCAGGTTCAGAACTATGAGTTAATTGA
CGCAATTGTCCTAAAAGGCCATTAAGTTTCACTGATTGTAGCCTATTCCAATATTTCCAT
TTTACTTCCTCACCGACTAAAAGCGTAGACTGTGTTCCGTTATTTTTGACAAAAAAAGGT
TTATAGACATCTTGCTCATTGAAGGGTTGACGACATGTATGACAAAGCGGAGGAATTATG
TTTCTTCTTTTTTGATACTGAATATGTTCTGACAAACAATCTCCGCAACAAGCATGCTTG
CAGTTCAATAACAAGGGATTTTGAATTGGTTCATTACAACATATGGGACATTCCGTTATC
AATGCTTCAAAAGACTTCAGTGTATCAATTTTTAAAATATCTGAAGGAATGGGCTTTCCA
GTGACAACAAATTGATTAATTAAAGAATTAAATTGCTCAACCGAAAACTCAAAATCATCA
AACGTTTCACTGTTAATGGTCATATTGGAAAGAAGCACAGGGTCACAACACGCCTGTCTT
AATCTTAAAAGTAATCCGAGGATCGTTGTATAGTTTCTGAACAGCGTTCCGGCAACTATG
TTTGCATTAACGGTACTTTTTGCTTTGGTATAGAGAGAGTCATAAATTTTCCTTTCTGAG
TCAGAAAAGTCCAAATATTCAATTTTTACGGTTTTTGGAGGTAACGTAACAATTGAGTTT
CCGTTTCTATCTTTAGTTTCTTTGGTTCTTCTCAAAACTAAAAACTCCAAAATTGATTGA
ACAACATTCAACGCCTTTAAGACATCTTTTGACTGATATGGCAGACTCACAAAGGTTTGC
CAATAAGTGTAATTACACCACGGCTCATATCGCATAAATTTAATCAAGCTATACAAGTCA
TCCAGTTTATTGACTATTGGCGTACCTGTAATCACCCAACGATTCTGGGACGAAATACTA
TGACACGCTTTCGCGGTTTTGCTTTCCCTATTTCTAATGTTATGTCCTTCATCAAGGACA
ACACGGAACCAATGCACAGAAAACAATCCCGAAGAATGAGATTGCTGACTAAATTCTGAA
AGTAACACACCATAACTAGTTATGATGATCAAGGGAGCTGTGGATGTATCAATAACACAA
GACTTCAGATCCAAAGGCTTTTCAGAACCATAATAAATCATGCTTCTGAATTTGGTGCCT
TGAGACACCTTACAAGCTTCGGAGTGCCATTGATCTAACAATGACATAGGTGCTACTACC
AAAGTCGTCCTACTGGCGACAGGAAGGCTGGGTTTAGAATGTCTAAAGGCTTCTGGTATT
TCATCGGTTGAAAAGCAAGGTCTAGAATGAATAAGTGATAATACTTCAATCGTTTTGCCT
AAGCCCATTTCGTCTGCTAAAATTCCACCCCGATGATAAGGCATTGAATTCGGAAACAAC
ATTGTAGTTTCGCCAGTATATAAGTTAACGTAAAAATGTGTGTTGTCATCATCACTAGAA
CATTTAAAGAATTCAGGGAATTCTGAGTCCTTTGGAAATCGAAATCGACTCCACAAAGGA
TGAAGCTTAGGTGCACTACCATCACTTTGTACGCCCTCTTCTTTACAACACATCCAATAC
AAAGCCTGTTTTTGATACTCACGAAGATCAAGAGCAAACGTTGATGGCTTTGGAGCAGAC
GGCAATTCAGCTCCAGAAGTTTTAACTTTGTCATATAATATAGCAAGTTGGTCGCTAACA
ACATCTTCCTCGTCTTCAGTTGAGGATGGGGTTAGATCTGAGTTACTCTCGTCCCTCGCT
TCAGGCAATGAACTTGTTTTCAATATATCATCAATATGAATACTCTCTTTAGTGTTGCAG
TCTTCAAGGTCTGGTTCCAAAGCTATCCAAGTAAACAAACGAAGTAAATGATCACGTTTA
TTTTGAGCAAAAGAGGCTTTTAAATGTTCTTCCTCTTCTTGCATAGAATTAGTTGCCAAA
GTGAATGGAGATCGGTTCAAGGACGGATGATTGACATTGATAAAACAATAAACTTGTAAA
GTGACATTACTCCCAAATCTAATTATATTGTCGGAGTAAATGCATATGGCTTCAAATGAC
CAAAAACCTTGCTCCATCAACGTTGAAATAACAGAAGCGACTTCAGTAGGTAATTTACCA
ATTTCATGATGATCTGAATTACAAAATCTAACGATATTGCTATAGCATGAAGAATTAATG
CTTAGCAATTTTGATTTTTTCCTAGAATTTCTCGATTGTGATTTTATGGAAAGTTTTTGA
CGTTCTAAATAGATCCTTTCGCCAGCCTGGAGTGTTCGAGTACCTGATGCAGTTGAATAA
GCCTCCACACCAAAGCATCCGATATACTTCATCAACTCATTCTTCTTCATAATAAAGTCC
AGCGGAGTAAGAGCATTCCGTGATTGCTTCTTCATCATTTCTTCTTTATCAATAGATACA
TCTTGAACAGAACTGTTAGATGACAAATTCAATGAAGGGCTAACAGCATTTAAGGCTTTT
TTATTTGTGTTCCTATTAATACTAAGATCCTTAACGGATACAGTATTAGATAATTGGTCC
ATCTGGGTCAACGAGGCATCAGTGTCTTTCTGACTTTCACTGTCAGGATTCGAATTCTTT
ATATTAAAGGATTCATCAAAATACATATCAACGGCGACATTCAAATCTCCATTCGAGGTT
TTCCAAATTTTTTGAGCTAAAAATTCCGAAATTGTTTTTTCACCAGTGACAGATAAAAAG
TCTAAAACCCATGACTCTGAAACTCCACTATCTCCATATTCCTTGCCTGCTGCGTTAGCA
TTTTCATGTTGAGAATTTGTTTTTAAGTCTACGATGGAATTCGCAGCAGTTAAATCATTC
GGTTTAGAGTCAGCTTCAACATCTGAATCAAAAAATCGAGGAGGAGAATTTTCTTCTAAA
GGGGCTTCATCTATAATTTTTTGTACCTTTCTTTTCATTTTATTGAGTTTCTTGGTAATG
TTTGCTTATCCAAACTTTAAGCTACCAAAAACTGTAGAAATATAAAATAACATGTATAAT
TTGACAACCAAAAATAACTTTTAAAAATTGCTTGATATAAACAAATTTAACAACTTTTTA
AACAATTCACCAAGTCCGTTAACTAGTAGATCCAACTTCTCTAATGAGCAAACATTTGAA
TTCTTTTAATTTAAATATTCTAATAGGATTATAAATGATGAAAGGAGACTCTAAAAAAGT
TGAATATTTGGGGAGGAAAATCTAATAATTATAGAAATAGCTCGCTGGCTAAATCTTGGA
GGAACTGGAAAAACGCGAAATTACCATTTTAATCTATTCTTATTTAATGCACTATAGTAA
ACCTCAGTAAATTGAATAACAACAATGTAATATGATATGCATTTTCTAAAAGGAGAAAAA
TGAAAGTAAACGCACATGACTCTCTTAATTTAAGGTGATTATTTTGTGCAGATATAAGTT
TACAAATTACTTAAAATGTGCCAACGTTATTATAAAAATATACTTTTAAATTTCCTGCTA
GAAGAGTAAATTAGACACTATAAACTAGGCCCTTAATTCATATAATACACCGGCAAGATC
ACATAATTTTATTAAATTTAAACAGACTCCAAAGGAGCAACATCAGAAATGACCTTGGAA
CCAACGTCTTGAGACTCACCGTGTAATTCAAGAAGCTTTTGGGCGTCGTGCTTGGGAGCC
TTCAAGATCTTTACCTTACGAACGAAAACGTTTTGCAAGGGATAAATGTTGTTGGTGGCC
TTCTCGATAGCCCGGCCAATAACCTCAGGAATGAGCTTTTGGACAAGCTCCTTCATGGAA
CAACCGTTGGCTTGGTTTTGGATGACCTGGAACATCTTTTGGTGAATGGCACGAATTTGA
GAAGATTGAGCATAAGTAGTCTTCTTGACTTGGTTGACACGACGGCTAGTAAAGCCAATA
ACGAAGATACGGCAAAGGTAACCATCGGTGGTCTTGATGGTTTGGTTGGCCTCAATAGTA
GATTGCCATTTGCGAACCAAAGAACGCAATTTGTCAGAGGTCATATCGAAACCGTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..5237
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved