Saccharomyces_cerevisiae Locus Mono:48:U3a
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:48:U3a
Saccharomyces_cerevisiae
Mono:48:U3a
XV
U3a
1001..1014,1172..1490
2490
ATATCAGGTAGGTTATCTCCTTCTTCTTTCCCTAGAAGGTAAACTGATCATTTATAATA
CCTTTCTCTTTTGAATTTTTTTCCTATGAAACTTGTTCATTCTGTTCTTCTCATCGCAAA
ACCATGCACTATTTAATATATTCATACTCTTTAATAACAGTTGTCCAACAAGTGCGGGCC
CCAACTATAACACATGTTTTATCGAATATCAATAATGTCTTCTAAGCTCGAATCAGCCTA
TTCCACGGCAACATTCATCATATAGTAATTTCATAACATACGTCTATGGGATTCAGCCAT
TTTATCTATGATTTATCTGGTTCTACTTTTGCAAAGGTTGTTTAAGCAAAGAAACTGTTT
TCGGACCTTTATCTGCTATAATAATCGTTTTTTCAAAATCTGGTGCTAAGCGTAACTGGT
GCAAGCCATAGGTAGCCTCACTACGGTACAGAGGTTACTTTGAAAGCAAGAACCCTTCAC
ATGTCACACCTGCACGCAGAGGCATGGAGAGGCCAGCACAAACCACCATGGATGGGTAAA
GTCATAGAAGGAAAAGCACATGGTACCCAGGCAGAGTTCCCCCCAGCAGTGACGCTCTGT
TGCACTGGCCGGAAGAAGATGGTGTAAAGAGAAGCGGTCTCCAGGCAGAACAAATTCTGA
TTGCCCGTCTACCGGTAAAGCTTTCTCACAATATACCGTACGTTTCAAAAAAAATATTGA
TTCTTTTTTTATAAAAATATCAGTAGTATGTATGGGCTGATTGTATGGGTTTATACAGGC
CGTCAAAATTTTTTCACCCCCCCATACCCCACATACCTTTTACTATTAACCCTGATTTTT
TTTCTTTTCACATACAGCGCCTTAAGGCGAAGGCAAATCCTGAAAATTTTCTCATTTGCT
TTCCCCCACCAGACATATATAAAGGCTTTGTATTCTGCTGTCAATTAGATTTAGTACATC
TTTTCTCTTATGTTTTCTTCTTGTTTCTACTTAAAATCTGTgtcgacgtacttcagtatg
taatataccccaaacattttacccacaaaaaaccaggatttgaaaactatagcatctaaa
agtcttaggtactagagttttcatttcggagcaggctttttgaaaaatttaattcaacca
ttgcagcagcttttgactaacacattctacagtaggatcatttctataggaatcgtcact
ctttgactcttcaaaagagccactgaatccaacttggttgatgagtcccataacctttgt
accccagagtgagaaaccgaaattgaatctaaattagcttggtccgcaatccttagcggt
tcggccatctataattttgaataaaaattttgctttgccgttgcatttgtagttttttcc
tttggaagtaattacaatattttatggcgcgatgatcttgacccatcctatgtacttctt
ttttgaagggatagggctctatgggtgggtacaaatggcagtctgacaagtTAACCACTT
TTTTCCTTTTCTAAATTGTTTAAAACCAAAGGTTTGGTTTTCAGTTAAGAAATTGGATTA
GTTGGTGTGTAAGTATAATTAAATGTAGTCTTGGTTAGCTTAATGTATAGGTTCTTGATA
GTATGACTCCACCTAAAATTCGTCAAGAGCGACGGATGCGAAAACAAAAAAATCGCTTTG
CATCCTTACGTGCGTGAGATGGCATCGCTGGCCAAAGGGAAACGTTTCATTATTTTCTGT
AGTTAACATTATGCTTTGCATGATAATAAGAGAAATTGAAGAGCGCAACGAACTACGAGC
ATGGCTGGAGGAAAGATTCCTATTGTAGGAATTGTGGCATGTTTACAGCCGGAGATGGGG
ATAGGATTTCGTGGAGGTCTACCATGGAGGTTGCCCAGTGAAATGAAGTATTTCAGACAG
GTCACTTCATTGACGAAAGATCCAAACAAAAAAAATGCTTTGATAATGGGAAGGAAGACA
TGGGAATCCATACCGCCCAAGTTTCGCCCACTGCCCAATAGAATGAATGTCATTATATCG
AGAAGCTTCAAGGACGATTTTGTCCACGATAAAGAGAGATCAATAGTCCAAAGTAATTCA
TTGGCAAACGCAATAATGAACCTAGAAAGCAATTTTAAGGAGCATCTGGAAAGAATCTAC
GTGATTGGGGGTGGCGAAGTTTATAGTCAAATCTTCTCCATTACAGATCATTGGCTCATC
ACGAAAATAAATCCATTAGATAAAAACGCAACTCCTGCAATGGACACTTTCCTTGATGCG
AAGAAATTGGAAGAAGTATTTAGCGAGCAAGATCCGGCCCAGCTGAAAGAATTTCTTCCC
CCTAAAGTAGAGTTGCCCGAAACAGACTGTGATCAACGCTACTCGCTGGAAGAAAAAGGT
TATTGCTTCGAATTCACTCTATACAATCGTAAATGAAACCTCTCCGCCCGTATATTTTTT
TTAATATGTTAAATAGTGATAGAACTGATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved