Saccharomyces_cerevisiae Locus Mono:47:snR9
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:47:snR9
Saccharomyces_cerevisiae
Mono:47:snR9
XV
snR9
1001..1187
2187
AGCTCTGGCAGGTCCTTTTCTACAAATTGCGACCACGAATCTTCTTCCTCACTGTCTTC
GTGATGTTGCTCCCTTTCGTTCGGATTATGACGTCTTCTGCGCTGTTCATGCATGCTTCT
AGTTGCGCGATCACGATTACGACGACGGGAATGTGAGCTGTTGAATTGCTCATCTAATTG
CCGTGCCAATAATTCGTCTTGTTCTAATTGAGTTTGTCGTCTTCTTGCCGGCGCCTCTGG
GTTCTTTCTTACAGGTTGTGTTGGTAACTCGATATCTTTACCAGATTCGGGATCTGATAG
GAATAGTAAGGCATTGAAAGCTGGGCTCAAAACACCCTGGGACGCAATGATCACCGCTTT
AATGTATTTTTCTTCCAAATTGGGAAAAGCATCCTTCAATTCTTGCAATATTGGATTCTC
TTTAGATGGCTCCTCCTCAGACTTCCTTCTGGCAGGTAAGGGGGGATGCTCCTCCTCTTC
TTCTTTTGCATCCTCAGCGGGTGTCACCACTTCGTCCTCATCAATTCCTGAGGACTTGTT
CACCTTTTCTTCAACCTTAGGTGTACCATCCTTGGCAGAAGTGTCATTATCCTTTTTCCC
ATCGGAATTTAGATCCACATCCGTCGTCTTTGAAATATCCTCATTAATTGATTCCGGAAC
ATTACTCTTCTCAAGGAGAGAAGAATCCTTGATACCTTCCTTTTCTTCCATGATTTTGAT
TTGGCAATATCGTTTTGCTGGGGGTGGCTACTTAACTAGTCTCAAGCTGTTTATTTGATC
GACTTCACAGCTCAACGCTATCTTCCCTCCAAGCCCTTACTTGCTAAGATTAATTTTAAT
AGGAAAAGAGAGAGACTCAACGTCTGTGATGACAATAAATCGCTGTTCAATTTTTTGAAC
ACTATATAAAGAGAGGGCCATTCATTTTTCTCACACTTTCAATCTTAAGTTTCTTCCCAT
TTTCCTCCTTCTCTTTCTTCTTCTTTCTTTCCTAAAACCTCGGGAATATAATACTAAATA
CTCTGTTATATAGAACTTTCTACGCCTTTTCCTCTATGGCTATGAAAGCGTGGACAACGG
AGACAAATAGACCAATTACTGAATATGGCTTTTGACATATCTTCTTCTTCATGGGTGAGG
ATTAAGCTGATATCCTGACCCACCTATCATTAGTCCTTCAGACATACTTTGCAAATATTT
AGACTGCATGCCAGTTACATAGCGTTTTTAAGCTTTCTTAACTCTTGCATCACTACGGAT
CTGGGATAAGTCCCAGCAGTATCGCCGACTGCTAGTCTAACGGCACGATCATCCAATCTC
ATGAATGGGTTATAACCTAGTTCATCTCTCAGGGTGAAGTGACCGGTGGTGCACTCGTTA
GATTTGCAATACTGTTCCAACGCATCAAACTCCTTGTTCTGCCCTATATCGGAATAGATT
TTTGCTCTGATAAAGCTAACATTGCCTTTGGTGTACTCATGACCAGGGTATATTTTAACC
TTATTCCAGTTCGTCTCACCAACAGCCCTTAACATTATCTGGTTTAAGGCCATGTCCATA
TCTCTTCCTGTGCCCTCGAAAAACCTCCCACAACCGGCAATGAATAAAGTGTCGCCTGTG
AAGATGCACTGCTCACCTGTTTCTAAATCTTTGATATAATAGCATATGGAATCTTTTGTA
TGGCATGGAGTCCTAATACATGTTACTCTTAAGTTACCCAAGTGATACTGCTGCAAATTA
TCGGGTACTTCAGTGACACCCGGGGAGGACTTAGATCCACCAATTATTTTAATATCGTGA
CCTGAGTTTTCTTGGCACAAGATACTATAAAGCGCTAGGTTCCCCCCCGAATGGTCATAA
TGGTGATGTGTATTGACAATAGCATCAATACTTTTTTTCTCTTCGGCGCTTAATTTTGGC
GACACCTCAAGTGGTTCTGCAGGGTCAATCAGCCATGAGTTTCTCCTGTCTTCAGTGCTT
AGTAAATAACTATAATTGACACCACCTGTCAACCATCGCATTTTTATAGGCTTAACATGC
ATATTTCTTATTTGCTGCAGTAAAAACTTCATGCCGAAAGAAATTTGCTGCACCAAAGAA
TGAGTAAATCTCCTCTTTTCAGTACTTCCAGATTAGTCTTCAAACAGCTTTTGAGTTTTT
AAAATATAAACCGCCTCTTAGTTCATAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved