Saccharomyces_cerevisiae Locus Mono:46:snR62
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:46:snR62
Saccharomyces_cerevisiae
Mono:46:snR62
XV
snR62
1001..1100
2100
ataataagtgtaagctcagacaacctttatctttatcaattaatggggaggcgggaaaa
ttaatagcctaagtgtgaaggagttgtcttcttgcgctttctgttcttttccgaataaaa
aaacaattaaattatcactggagaaaatgcttctcaattaaaaaaatcactaaataacgt
tgtttctcttttcccttatttttaatgggataaacgttctaacaaaactttttttgtctt
ctaaatttggatccttatcttcttatgacctttggggggagaaaagaaaaaaatgactct
aaactgacgccgagttagagactctctcacactctatcactatgcctatgctgtaaactt
aaaacaacgatagaccgttttttgtcttactttcctccttagtaattattactctagagc
ataagaaattggccattgaacatggcccgttctgactaaaatcttctcttcctgataaaa
tttgctttttttattttgaattgccctccttcgggtcgtttggaaaaaacacccaaacac
ctcttacatacaagatttgcaacgttttgataagtaagtacattatgcagaggttatgtt
ttttcttgaccgtcaaaacactgttcatgcatgctagcgctgtcgatataaaatcgggat
tttcatacacccatcaggttggttgaattctttctttaactcttactcatctttctttat
tttccggatatagcacgtaacctatcatttttttttcttaaggttgcctttgccgttctt
cgcactataaaaaagcacgcttatgaaaatttttaattacttgactttttaaatctgtca
ttgaaatttagatgatatgcaaaacacattacgaaaatgtcaattggagttttaaagaac
tcatgttgctgttacaatacgtagaatggtcagaagtgtgctgatgcatatactttgaag
tgtcaaagtgtctgaacgggtgccgtaaaagacctattcttttttatgatgaatttatgt
tttcaatcttatctacattatctgaattaatagctaacaatagttataatggaagatata
cgactatcaacaattctgaaaattttttcttacttccttcaagaaggtagtgagttcttc
acaagcgcgtaaaataagatgcgtccaaatattggcacgtatacacatgtacgtagatat
cagctttacatctcgtcgtcactattgattaagaattcatcctcatccggatttttctta
tttctagaaacagcgtttactttagttggtgtagtatccaggggttccggtggtagcggc
tgccatttcttcttcgtttctgtatctggagtatcaatgtaggttgtctctgccactact
tttccagtcgactcaccagattttgttctcgttggtaactgaggtggcacatcttcatca
tcttcaaatccatcttcgttgtgtagtgtgattccgtggctttctaaagagtcatcaccg
acttgaacgccaaacgaattgaatcttcttctctcaggttgctggggtcttgaatttttc
ccgccttgtgacaaatccacaatctctggctcccattcttgctgatcttggtgaccatgt
tggttgtcgttttgctcattacctgacgcaaagtttctccggtaagcatcacttatccag
ttactaactttgtttgctgtgtcctgtaatgaccgaccggctctgtccgtaagctctggc
aggtccttttctacaaattgcgaccacgaatcttcttcctcactgtcttcgtgatgttgc
tccctttcgttcggattatgacgtcttctgcgctgttcatgcatgcttctagttgcgcga
tcacgattacgacgacgggaatgtgagctgttgaattgctcatctaattgccgtgccaat
aattcgtcttgttctaattgagtttgtcgtcttcttgccggcgcctctgggttctttctt
acaggttgtgttggtaactcgatatctttaccagattcgggatctgataggaatagtaag
gcattgaaagctgggctcaaaacaccctgggacgcaatgatcaccgctttaatgtatttt
t
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved