Saccharomyces_cerevisiae Locus RPL7B
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae RPL7B
Saccharomyces_cerevisiae
RPL7B
XVI
snR59
1676..1753
3551
TGTTGTTATATTGAGGATGTGGTTGTGCATTGTACTGATTAGTGGGGGCATTCACTGCG
GGGCCATCCATCTGCATTTGCACACCTTGCAACTCAAGCACCAAGACTCCTGAATTTCCT
TTTTCCAAATGGTTTCTGATACCATGCTTAGCACAGAACTCCTCAATTGACGGTTTGAGT
TTCGCTATACCGTTTTGAGAATGCAACCCTTTTCCAACAATAACGTTCAGTTGTGGTTCA
TTATGATCAATAGCGAATTTGATTCTTTTTTGGAGAATAAATAGGGCCTCTTTTACGTAT
AATCCATGTAAGTCAATTTCATTACTGGAAGAATCAGCATTGTTCTCTACAAACACATAT
TCTGCCGCTTGCATGTTAAAATCTTCAGCGGTTTTCAGTTGTGCCTTACTTTTCTCGCTT
AGTTCATGAGCTAGCTTCTTGTCACCTTGTTGATAAGCGGTTTGCGATTCATGGCTGAGT
TGGTCTCTTTTCTTATACGCTTCATCTGCTAATCTTCTCAATCTTTGATACTCTTCATCA
GTGCTATGATTGTAGTCCCTTACAGGATTCTGAGTTCCGACTACTACTCCACCTGTTCCT
TTCATAGTTTTAAGTGCGGCGCTTTAGCTTCAAACTGACTCATGGTTGCGTAAAAACATG
GTTGCTTTTTGTCGTTTTCCTCGAAAGGCTTTACCTTTTCATTAAGCCGCTCCATTTTAA
AATGTTTTAATAAATCCACTTTTTTCCGGCGCATAATGGATCCAGAAAGGAACTGGCAAC
TAAATCCGTACATTTCTGAAATTATTTCAGTTCGCAGATTATTTTCTCAGTTTTACCGTA
TATTCTTATGTATTACAGTTGAGGTACCCACACGCGCACTTGAAAAGTATATAAAAGTGA
AATATTTCAGAGCTCTTCCTATTGCTTTTTCAATAGAGGCTTAAATCTTCCTCGTTTGTA
GAGTAAGTAGACCCATATTACAAATCTCCATCAACGTCATAATGTCCACTGAGTATGTCA
AAAACTACAAATACGACCTTATTTGGTAACTAGTTTGTTGTCGGTTACATCTGAATTTGA
AGTACCCAAATTGATAATACTTCAGGAAAAGTTAACGCACATTCAAAACGTGTTTTTTTA
CAATAACCTATGGTGATCGAACCTAATTATAAAAAGAAGCACTTGAAGTAGTTTATCTTC
TTCAAGTACCTTTCGTAGGGGATTTTCATTTTTAATGAACAAAGGCATTGTTTGTTAGTA
TCTATTACTTGTAATACACCGATAATTTCATTGATAGATATTTCCAGCATGTCTCTGCAT
CTCCCTTCCATCGAATGAAAAGTGGTGTTTTCAATTCGATGTAACTGAATCTTTGTTCTT
AATATGACTTCTTTGCTAACATTTTTTTCATTTTTGAATAGAAAAATCTTGACTCCTGAA
TCTCAATTGAAGAAGACTAAAGCTCAACAAAAGACTGCAGAACAAATTGCTGCAGAGAGA
GCTGCCCGTAAAGCCGTATGTTCATTTACCATGTTTGAAAGATATTATATCATTCCTTTT
ACAGTGAGTTCACAAAAATATAATACTTTGTTAAAGAGATCTTTTCTCGGTTTTACATTT
CCTTGGCATTTGTTAGTCGCGAACAATTTTCACTTTTTGCAACGTTTTTTTTCTTTCTTA
ATGATGAAAACTATTCCTTATTCTCGACTAGTCTTTGACAATGCTGTCGTTTAATCACCA
TCTTTCGGCTGACTAGTAAAGAAAATGCAAGAGTGAGAATATGCCAAGAATCTGCAAGAT
TGAGTTAAGTTTTCTTAGAAAGTTTTATCGTGCATATTTTTCACTAAATTGGAATGACGT
TAAAACCAAAAGTACTGATCTTACTAACATTAATCAAAAATTCTTGATGAATATTATTTT
AGGCTAACAAGGAAAAAAGAGCTATTATTTTGGAAAGAAACGCCGCTTACCAAAAGGAAT
ACGAAACTGCTGAAAGAAACATCATTCAAGCTAAGCGTGATGCCAAGGCTGCTGGTTCCT
ACTACGTCGAAGCTCAACACAAGTTGGTCTTCGTTGTCAGAATCAAGGGTATTAACAAGA
TTCCACCTAAGCCAAGAAAGGTTCTACAATTGCTAAGATTGACAAGAATCAACTCTGGTA
CATTCGTCAAAGTTACCAAGGCTACTTTGGAACTATTGAAGTTGATTGAACCATACGTTG
CTTACGGTTACCCATCCTACTCTACTATTAGACAATTGGTCTACAAGAGAGGTTTCGGTA
AGATCAACAAGCAAAGAGTTCCATTGTCCGACAATGCTATCATCGAAGCCAACTTGGGTA
AGTATGGTATCTTGTCCATTGACGATTTGATTCACGAAATCATCACTGTTGGTCCACACT
TCAAGCAAGCTAACAACTTTTTGTGGCCATTCAAGTTGTCCAACCCATCTGGTGGTTGGG
GTGTCCCAAGAAAGTTCAAGCATTTCATCCAAGGTGGTTCTTTCGGTAACCGTGAAGAAT
TCATCAATAAATTGGTTAAGGCTATGAACTAACATTATTCCGTGTGGCAATAATCTCAAT
GTATAATAAATAATATTTCTCTTCATATATATGACCGGACTCGTAATAGAATAATTGACT
GGAACAATAGCGCATATTGCTTTGCTTCTATACGTAGTTGAGTTTTCACTCACGTACAGC
TAGAGAATCTCACATAGGAGTATCCCTGTAGTTAGTTCCGCGCGGTTCGATCACGGATAT
ACTTTCAACAATGGCAGTATGAAAGCCTGTTATAAAAAAGAAGGAAACAATAAACGAAGT
GCTTTTTTGCCTCCTAAATTATTCAATTTGACAACTGATTTCCAGCCATTCATTATTCAG
TGAGGAGCGACAATGTTTGGAGTCAAGGATGCTATATTCAAGATTAAACGTTCCATTGCA
GGCACAGATTCTTCTGATTCCACTGCTTACACAACGGCAAGTGAATCTTCACCTCAATTA
AAAGATTCCCATAACCCCTTTCGAAATAAAACGACATCCGAGAGAACTATAGTTGAGGAG
GGCTCTCTACCACCGGTGAGATTGAATGGCTACTTGCCCTCAACTAAAAATAAACTTCTT
ACTCCTGAAATGTGCGATGAAATAAGAACATTAATGCCCACGAGGATACAGTTGTACACC
GAATGGAACCTTCTATATAGCCTTGAGCAACATGGGTCTTCATTACACTCCCTGTATAGT
AACGTTGCTCCAGATAGCAAGGAATTTAGAAGAGTGGGGTATGTATTAGTAATAAAGGAT
CGTAAAAACGGAATCTTTGGAGCTTACAGCAACGAAGCTTTTCATCCTAACGAACATAGG
CAATACACAGGAAACGGGGAATGTTTTCTATGGAAGCTGGATAAAGTACCTGATGTTAAT
ATATCCGAAAAAGAAGAATCTGAGCAAGAAGGTAAAGAAGGTAAGGAGGAAGGGGATAAA
GAGGAGAGATGGAGGTTTTCAGGTTATCCTTACACTGGAGTTAACGAATTTGCTATATAC
TGTACATCTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1011, 1421..1514, 1922..2551
1001..1011, 1421..1514, 1922..2548
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved