Saccharomyces_cerevisiae Locus NOG2
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae NOG2
Saccharomyces_cerevisiae
NOG2
XIV
snR191
1902..2175
3992
AGAACAACCAGATAAAGAGAATGGAGAAAAGCTCGATCGAGAAGTAGAAGAACAAGCTT
CGTCCACCACTTCACTGGATTTAAAAACAGAAAAACTAAGGCAACTGGTAAAATCAAAGG
CCGCCAAGAAGTCTAAACACAAGACTGGGGTGGTATACTTCTCCAGTATTCCACCTTACA
TGAAACCTGCAAAAATGAGACAAATATTAACTCGTTTTGGTGAGGTAGATAGACTATTTC
TAAAGAAAGAGGACGATCAAAAGTACAAGCAAAGAGTTAAAGGTGGAGGAAACAAGAAAA
ACAAGTATGAAGAAGGTTGGGCCGAGTTTATTAGGAAAAGAGACGCCAAATTGTGTGCGG
AGACGTTGAACGGGAACATTATTGGTGGCAAGAAAGGTACTTTCTACCATGATGATATCC
TGAACGTGAAGTACCTCCCAGGTTTCAAATGGGCAGATTTGACTGAACAGATTGCCCGCG
AGAACGATATCAGACAGGCCAAGTTGGAGATGGAAATCTCGCAGGCCAACAAACTGAACG
CGGAATTCATTAGAAACGTGGAGCAAAGTAAGATGATACAAAACATTAAGAACTCTAGGA
AGCGCGCCGGAAAAGAAGGAGAGTCTGCAGATTCTCACCCTCACAGGGAATTTAAACAAC
GTCGTGTGGAAACAAGCCGTGCCAATGCTCCCTCTGATATCAAGCAGCAATCCTCTGGGT
CCAAAGACTTGGGTAATGTTCTCACCAATTTACTATAATATAGAATCAATAACAAATATA
TAAACACAACCTGTCATTTAGCACGTTTTTTTGCCCGATGCTCATCGCAAAAATTTTTCG
CTTGAAGAAAAATTTTTCACTTTTCTTCTTTTTGGGCATATAAAGAAGCGTAGAATATAT
AAAAGATATTTACTACTTGTTAGTACTTTCCCTTAAGTGTTAACTTTGAAGATCTGTTGA
CTTGCAGCAAAACCACTAAATATCAGGGGAGGAATAATACAATGGGTACTGGTAAGAAAG
AGAAATCTAGACGTATTCGTGAAGGTGACACCAAAGATGGTAATCTTCGTGTGAAGGGTG
AAAATTTCTACAGAGACTCCAAGAGAGTCAAATTCCTGAATATGTACACTAGTGGGAAGG
AGATCAGGAATAAGAAAGGTAATTTAATTAGGGCCGCTTCTTTCCAGGACTCCACAATAC
CGGATGCGAGGGTCCAACCAGATCGTCGTTGGTTCGGTAACACAAGAGTGATATCTCAGG
ACGCACTGCAGCATTTCAGAAGTGCATTGGGTGAAACCCAAAAAGATACATATCAAGTTC
TTCTGAGAAGAAATAAGCTTCCCATGTCATTGTTGGAAGAAAAGGACGCAGATGAATCCC
CAAAAGCCAGAATTTTGGATACCGAAAGTTATGCTGATGCGTTTGGGCCCAAAGCCCAAA
GAAAGAGACCACGTCTTGCTGCATCCAATCTAGAGGACTTGGTCAAGGCTACAAATGAAG
ACATTACCAAGTATGAGGAAAAGCAAGTCTTAGATGCCACATTAGGACTAATGGGGAACC
AGGAAGACAAAGAAAATGGGTGGACCTCCGCAGCAAAAGAAGCTATTTTCAGTAAGGGTC
AATCCAAACGTATTTGGAACGAATTATATAAAGTCATCGATTCGTCTGACGTGGTAATAC
ATGTTCTAGATGCAAGGGATCCATTGGGTACCCGTTGTAAGTCCGTGGAAGAGTATATGA
AGAAGGAAACACCACACAAGCATTTAATTTATGTTCTTAATAAGTGTGATTTGGTACCTA
CCTGGGTTGCAGTATGTTAACTTTTTTTTTTTTTTTTTTGATTCTTTCCAACCAAGAGGA
TAGCACGAGAGATTTTTTTTTTCGATAGAGTATGATTTTTATTACCAAACCTTTTTGTCA
GGGTGCTTCTCTATCCGTTTTAGGATAAACTTATCTACAGAAGTGTCTGTTACTGTTTTG
GAAGAGTAATACTGTTCGCTTATCCATATTTCCCCGTTCTGGGGAAGCCTCATGGGTAAA
TTAGAAGGACAACCTTTGTTTTAAAGGTATACCTTCGCTTTTTAGAACAGCGAGGATCTT
ATGAGTTGAGCTTTTGTTATTTGAGACTTTATCTCGGGCTCCATACAATATGTTCGTAGT
AAAGATCCTCACAATTTTCTACTTTTTTTTTTTTTTTAGTTTAATCCACTCTTCGAAACA
ATCAATCTCGGCTATAACAATGATTATTACATTCTCTTGGGGCAAAAGATTACCTATTAT
GAAACAAAATGTATTTTTTACTAACAGAAGGTTTTTTTTTTCAATTCTAACTTTACAAGT
AGGCAGCTTGGGTCAAACATTTGTCAAAGGAACGTCCAACTTTGGCGTTTCACGCATCTA
TTACCAACTCTTTCGGTAAAGGTTCGTTAATTCAGTTGCTACGTCAGTTCTCACAGTTGC
ATACTGATAGAAAGCAAATATCTGTAGGGTTTATCGGCTATCCAAACACTGGTAAATCGT
CCATCATTAACACATTGAGAAAGAAAAAGGTGTGTCAAGTTGCACCAATCCCTGGTGAAA
CTAAGGTCTGGCAATATATTACTCTTATGAAAAGAATTTTTTTGATTGATTGTCCAGGTA
TTGTGCCGCCTTCTAGTAAAGACTCCGAAGAAGACATTTTATTCAGAGGTGTTGTCAGAG
TCGAACACGTCACACACCCAGAACAATATATTCCAGGTGTTTTAAAACGTTGTCAGGTAA
AGCACTTGGAAAGAACTTACGAGATCTCAGGATGGAAGGATGCCACGGAGTTTATTGAAA
TTCTGGCAAGGAAACAAGGTAGATTACTGAAGGGTGGTGAGCCTGATGAGTCTGGTGTTT
CTAAGCAAATATTGAATGATTTTAATAGAGGTAAAATCCCTTGGTTCGTCCTTCCACCTG
AAAAGGAAGGGGAAGAAAAACCAAAGAAGAAAGAAGTTGAGAAGACGGCATAGAGGTAAA
AACGGACAACCGGTGTATAATATTAATTTAAGATTACAAGTGATTTTTTTTTTCTTTTTT
TTTGTTATTTTTTTTTTTGTTCTTATTATATGGCAGCAAACATTCTTGGGGAAACAACAT
AGATGGGTAATTATTTAGTTTATAAAGTATAATATTCCAATAGAAAACTTAAGTTCGGTA
ATGATATAGCCCTCTCTATAGTATAAGGTAAATCTCATTATACCAGTCATTCCAAACGGA
ATTCGGTCCTTACCCGCTGCTCGCTCTTTTTTCATCATTATGATATTTTCTTTATTGAGT
CTTTTCAATTATAGTAGTAGAATGATAACTGACAAGAAAGATCAGTTTGAAGTTTATTAG
CGTGTCTCGTTATCAGGGCTTCCTTGTTTTTCATACTGGAAATACTTCGAACGATTAGAA
ACAGGCAACTCAATTTTATACATTTATAAAGGGTCAAAAAGGATTATGCAATCTATGAAT
GTACAACCGAGGGTATTAGCTGTAGGAGGTGAGCAGTTTTTCTCTCAGAGGCAGGCTTCT
GAACAACACCAGCAGCAAAACATGGGACCTCAGGTGTATTCGCCAAAGGTTAATAGAGCA
AGAATGTTTCCTCAAGGGATGCCTGTAAATACAATTAATGGCTCTGTTAATCAGGAGATG
AACAATGCCTATCTTTTGAAGCAGAAGAACGAGCCACTGTTAACTCAGCAACAACAGCAA
CAGCAACAACAACAGCAGCCATTTAATATAGGAACGCCTGTTTCGGTGGCTAGTTTGCCG
CCCGGACTGAACGTTCTGCAGCAACAACAACAGCAGCAACAACAACAGCAGCAACAGCAG
CAGGGAGTGGGACTCAATCGTCCCTTGGCTTCCCAGCTACCCAAGCATTTAACCAACCAA
AGTATGCCACCGATCTTTTTACCACCCCCAAATTATCTTTTCGTTCGCGATGTCTGGAAG
TCCAACCTTTACAGTGAATTCGCCGTTATAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1810, 2342..2992
1001..1810, 2342..2989
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved