Saccharomyces_cerevisiae Locus ASC1
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae ASC1
Saccharomyces_cerevisiae
ASC1
XIII
U24
1617..1705
3233
AAATGTTGCTAAATTGGAGGGAGACTTAGAATATACTAACGAAGAGAGCAATGAGTTTG
GTAGTAAAGACGAACTAGTTAAACTTCTGAAAGATTTGGACGGATTGGAACGTAATATTG
TGTCACTTCGAAGTGAATTGGACGAAAAGATGAAATTGTACCTCAAAGATAGTGAAATAA
TATCCACACCGAACGGTTCCAAAATAAAAGCAAAAGTAATTGAACCTGAGCTGGAAGAAC
AAAGTGCGGTCACCCCGGAAGCAAACGAAAATATTCTAAAATTGAAGCTATACAGATCTT
TAGGAGTTATTTTGGATTTAGAAAATGATCAAGTCCTTATTAACAGAAAAAATGATGGGA
ATATTGATATTTTACCCTTGGACAATAACCTCAGCGATTTCTATAAGACCAAATACATCT
GGGAAAGATTAGGAAAGTGAAAATTGAGATCATTAATAAAATACTACAGTGGCATACATA
TTCAATGAGCTGAGCATAATTATTAGCATTATGAATTGGAACCACGTATTTTGCTCGGTG
TGATATAACTACAATATTTACTCTAGATGCACCATTCTACGTTTAAAAGATACTGGACTG
TCACAACGTAACTGGTTTGTCAAAATATTTGTTTGTGTTACTGGTAATACTCATCACCAT
ACTTATATTCCCCCAAACCTGGCCATCTGTAGCCTTATGACTATGTACGGATGTTAGGCC
GTCTTCGTTATCGCTCCGTTCTGAAAATTTCTTAGCGAGGACGTGCTTCTCCAGCGAAAG
TCTCAGAACGTTTGTTGAAAAAAATTTCATCCACGCAACTTTTTTTTGGATGTGTAAGAC
CAATTTTTTTGGCATTGGGCTATTCCTTTAATTGTGGATTTTCTACAACTTGAAAATTTT
CCTATATTTAAGACTGCTCCTTTGGTTTTCCTAACTCGTTCTCTCTCTCTTTTTTTTTTC
CAAAAAATCCTTATAACACACTAAAGTAAATAAAGTGAAAAATGGCATCTAACGAAGTTT
TAGTTTTGAGAGGTACCTTGGAAGGTCACAACGGTTGGGTCACATCTTTGGCTACTTCTG
CTGGTCAACCAAACCTATTGTTGTCCGCTTCCCGTGATAAGACTTTGATCTCCTGGAAGT
TGACTGGTGACGACCAAAAGTTTGGTGTCCCAGTTAGATCTTTCAAGGGTCACAGTCACA
TTGTCCAAGACTGTACTTTGACTGCTGACGGTGCTTACGCTTTGTCTGCTTCTTGGGACA
AGACCTTGAGATTATGGGATGTTGCCACCGGTGAAACCTACCAAAGATTCGTCGGTCACA
AGTCCGATGTTATGTCCGTTGACATTGACAAGAAGGCTTCCATGATTATCTCTGGTTCCC
GTGACAAGACCATCAAGGTCTGGACCATCAAAGGTCAATGTTTGGCCACTTTGTTGGGTC
ACAATGACTGGGTTTCCCAAGTCAGAGTTGTTCCAAACGAAAAAGCTGATGATGACTCTG
TCACCATCATTTCTGCCGGTAACGACAAAATGGTTAAGGTATGTGATATATTTTCTTTCC
ATGATAGAATATGATGACAATCGAGTAGAAGAAGAAAAGTGGATTTGTGTATGCCATTCA
AATGATGTAATAACATATTTGCTACTTCAGATGGAACTTTGAGTTCCGAATGAGACATAC
CAATTATCACCAAGATCTCTGATGAATGGTTTAGCATTACTCTGCTCTTCTCTTTACTCG
TTATGTCAAAATGGAAACTTTTTTTTTAAATTAATTTTGTTCCCTTACTAACAAAAATGA
TATAATGACAGGCTTGGAACTTAAACCAATTCCAAATTGAAGCTGACTTCATCGGTCACA
ACTCCAACATCAACACTTTGACTGCTTCCCCAGACGGAACTTTGATTGCTTCCGCTGGTA
AGGACGGTGAAATTATGTTGTGGAACTTGGCTGCTAAGAAGGCTATGTACACTTTGTCTG
CCCAAGATGAAGTTTTCTCTTTGGCTTTCTCTCCAAACAGATACTGGTTGGCTGCTGCCA
CTGCTACCGGTATTAAGGTCTTTTCTTTGGACCCACAATACTTGGTCGATGACTTGAGAC
CAGAATTTGCTGGTTACAGCAAGGCCGCTGAACCACATGCTGTTTCTTTGGCTTGGTCTG
CTGACGGTCAAACTTTGTTTGCCGGTTACACCGACAACGTCATTAGAGTTTGGCAAGTTA
TGACTGCTAACTAAGAATATGTATAAAGTTCATTTGTTCTTTTATGTATCTTCTAGTTAT
TGGTCATGTTTAAAATGGTAAAAATAAAGAAAATAATTTCTATATTTTAGTGTATAATAT
AATCGTCATAGATTTCGAAGTAATGAAAGAAAGGTTATCATTAGGTACTATAAACTATGC
TTTCTGTTTGCTGCGAAAATACATATGTACAGTTGAAATATTTATTATTTTTGTCTTCCT
TTATTTCCTTTATTGTGGTATTAGTTTAAACCCTCTTTTTTGGCCGCTTTCAAGACTGTC
GTCTTTTCTAGTTCCTTTTCAGCTTCTGCAAGGAGTTCATTAAATTCAGTCTCCTTGGCC
ATAGTGATCGAATCTTTGAATAGTTTTTCAGCTTTAGCCAAAACACCTTCATGAAGGCTT
AAAACCCCCATTCCATAGGTAGATAGAGCAATTGACTGTGCAATTGAAGGATCCAGTTGA
TCCTTCACATGAAACCTAATTTTTCTGTTTCTTTTGGCAAACGCAATAACGCTGTCGTAA
CATTTTTGTGCTCTTTCCAGACATAAGTCACGATTTTTGCGTACGAATCTAACGGCTTTT
ATGTATGTTCCCATATCTAACTCTTGGTTGGACTCTTTACTTTTCTTTTGCTCTAATTGA
TTTAAGTCAGCTTCTAGCTTTTCTGCTTGAAGATAGAACAATGACCCCAAATTTGCCTGT
GATAGCAATATCTGTCCTGGTGGCATGTCTGCCATAACCATCCATTCCACACTAGTTATC
TTGCAACTTAGAGCTGCAGCTATGTCTTTTGATGACAGACAATAAGCTGTATATAAATCT
CTCGCAGTAAAAAATTCTTCCTTAAAGGGTTCCCAAGCGCTGCTATTCTTTTCCAGATCC
AAAATCATATAGCCTTGCTCATCAAACTTAATATTTTCCTCACTAACAAATGTTTTAAAA
TCATCATTAGGGTCTCTATTGATGTCTTTTACCATCGAGAGCTTCTTTTTTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1537, 1811..2233
1001..1537, 1811..2230
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved