Saccharomyces_cerevisiae Locus IMD4
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae IMD4
Saccharomyces_cerevisiae
IMD4
XIII
snR54
1557..1642
3983
CTGAACAAGCTCAACCAGATATAATGGTTCGTTCTTTTCGAACTTTGTCTTTACATATA
TTTCCTCCTTTGTACCTCTTCTCTTTCCCACATAAACAGTCCCCTTTTCAATAAAACGAG
AGAAATACCAGAAAAGTAGCGAGAGCACAAAATATGCGCCTACCAAAAGCTTTTGATACG
TAACAATCTGATCTCTCTCAAATTTTTTATCCAAGAAGAAACTCAAACCAGCTACAACAG
CTATGGAATAACCTATGTACAATTTAGCATCGAGTAAAGCGTATGATCTCTCGTAATTTA
ATCTCGCGAAAACAGAAGGTAGGGCTTCATCTAAAGCTTGGTTCAACTCCGGGATTGAAT
ATACATTAATAGGTTTAGCAGAACTCATCTTGAACAGGCGTCTCTTTTCCTTACAATAAC
TTGTGCTTTTCCTTCTATAATTCCGTTTCAACGTGTACAATTGTCATTTTTTGTCTGGTA
TGATTTTGCAGAACTGAAAAAATCTCTTAAAGGTTCCGCCTCATCAAGAAGGCATATTCC
TTTACAAAAGTACATTGATCTTACAAGAAGCTAGCTAATGGTACTATTTAAAAAACAACT
ACACTCCATCAATACATAAAATTGTTATGATAGACTTGAGGGACGCACTAGTGCTTTTAA
TCCTCAAATCTGCTTACTCTTTTCTTTCTGGCAGCCCTAATGTGAAAAACTCTTTGCCGT
GGCACTTTTTCGTTCCTTTTTTTTGCTCTTCGAGATGCTGAAAAAAAAAAAAAAAAAAAA
AAAAACTGAAAAAGCCATATAAATATCAGTTGAGAATCCATCCGATTCAAATCATGCTTG
GCTCATCGCATTTTTTCATCTCTTTTTCTCAAACTCTTGGGCTTAAATTTTTTTACGAAA
AAATGGTGGCTTTTACATTTTCTCTGGTCTTCTTTGCTGCTTGAACCAAAGGATATTGGA
CCAATTCCATAGCTTTGAAGAAACCTAACAAACATTTTACGATGAGTGCTGCTCCATTGG
ATTACAAAAAGGCTTTAGAACATTTGAAGACATACAGTTCCAAGGACGGTCTTTCTGTCC
AGGAATTGATGGACTCCACAACTAGAGGTGGGTTGACCTACAATGATTTTTTGGTCTTAC
CAGGCTTGGTCAATTTCCCATCTTCTGCTGTCAGTTTGCAAACCAAATTGACCAAGAAAA
TCACTTTGAACACTCCTTTTGTCTCTTCTCCTATGGACACAGTCACTGAAGCTGATATGG
CTATTTATATGGCTTTATTGGGTGGTATTGGTTTCATCCATCACAACTGTACTCCAAAGG
AACAGGCTTCCATGGTCAAGAAAGTTAAAATGTTTGAAAACGGTTTCATCAATTCTCCAA
TAGTAATTTCTCCAACCACCACTGTTGGTGAAGTTAAGGTTATGAAGAGAAAGTTTGGTT
TCTCTGGCTTCCCAGTTACTGGTATGTTATAATAGACAAAATTTTTGGTATTATGTTTCT
TTCATTAGAATGCGCTTTTTAATCATCCATAAAGTTTTCCAAGGTGTGAAAAAGATCTAA
GATGATGATCAACTTTTTATATCAATAACTTTCGTTCTACTGACTGTGATCAAACGATCT
TGTAGAGAACTTTTACTCTGAATTAAATCATATTCGCACCTTTTTCGGAAAGCCCATTAT
GTGTGATTAATTGACGTGCAGTGCACTTGAGGAACTTAATATATGTGATAAAAAAATATG
TGGCTTATTTTACTAACATTGCTATGTAAATACTGTTATTTTTTTTCTTTTCTGGCTGGG
CTGAAAATTTCTTCAGTCTTCATAAAGTTGAGAAAATAAAAGGAAACAAGTACATCTTTT
TGAACACAGAAGACGGTAAGTGTCCAGGTAAGTTAGTTGGGTTAGTCACCTCTCGTGATA
TACAATTCTTAGAAGATGATTCTTTGGTTGTTTCTGAAGTCATGACTAAAAATCCAGTTA
CTGGCATCAAGGGTATTACTTTGAAAGAAGGTAATGAAATCCTAAAACAAACCAAGAAAG
GTAAATTGCTTATCGTTGATGATAACGGTAACCTCGTTTCCATGTTGTCAAGAGCGGATT
TGATGAAGAATCAAAACTACCCGTTAGCTTCTAAATCCGCCACCACCAAGCAATTGCTAT
GTGGTGCTGCAATTGGTACTATCGAAGCTGATAAGGAAAGATTAAGACTATTAGTCGAAG
CAGGTTTGGATGTTGTTATCTTAGATTCCTCTCAAGGTAACTCTGTTTTCCAATTGAACA
TGATCAAATGGATTAAAGAAACTTTCCCAGATTTGGAAATCATTGCTGGTAACGTTGCCA
CCAGAGAACAAGCTGCTAACTTGATTGCTGCCGGTGCCGATGGTTTAAGAATTGGTATGG
GTTCTGGGTCTATTTGTATCACTCAAGAAGTTATGGCTTGTGGTAGACCACAAGGTACAG
CTGTCTACAACGTTTGTCAATTTGCTAACCAATTTGGCGTTCCATGTATGGCTGATGGTG
GTGTCCAAAACATTGGCCACATCACCAAGGCTTTGGCCCTTGGTTCCTCCACCGTCATGA
TGGGTGGTATGTTAGCTGGTACTACCGAGTCACCAGGTGAATACTTCTACAAGGATGGTA
AGAGATTGAAGGCTTATCGTGGTATGGGGTCCATTGACGCCATGCAAAAGACCGGTAACA
AGGGTAATGCCTCTACTTCTCGTTATTTCTCTGAGTCAGACAGTGTCTTGGTTGCACAAG
GTGTTTCTGGGGCTGTCGTAGACAAAGGTTCCATCAAGAAGTTTATTCCATATTTGTACA
ACGGTTTACAACATTCTTGTCAAGACATTGGTTGCGAATCTCTAACTTCATTGAAAGAGA
ATGTTCAAAATGGTGAAGTTAGATTTGAATTCAGAACCGCTTCTGCTCAATTAGAAGGTG
GTGTCCATAATTTGCACTCCTATGAAAAACGTCTATACAATTGAGTAAGCATCCATAGAT
ATTTAAAAGTTTATTTTTGCATATAAATATACCTTCATAGAGATCAACAAAACTAAAATA
AAGAACAGACCTAATAAAACGCTATATGATTCTGTGCATTTGAGGAGCATCTAGCTTCTA
AATAGATAATTAATGCAACTTACTTACTTATTGAAGTATGTACAGTGGAAATAGGAGCTT
TCTCTATTTGCTATCATTCTTTGCATCATGTTCATGTACTTTCTGCCAAACTTTTTCGTA
GTACTTCTTATTTTCGTTTTTCAGTTCGTCTAGTGAAGGCGGTAATTTTTCATTAATTAA
ATCGTGCTTTCTTGCCCTTTCAAAGGTAGACAGGGCTTCATCTAAACCCTTTACACCATT
AGATAAAGCGCCACGTGGCAACACGCCTGAATTGTGATCTTTTAAAAACTGAACTTTATT
GGTTTCTTCTCTGAGAACAGAATACATTCTGGAAACTTTGGCGACGGCCAGAATCTTATT
TCGTAAGGCTTTCCTTCGATGTTCGTCATCTAAAATGGAAGCATGTTTAGGCGACGCCGA
AGTGGCTGGTTGTGGAGTTGCTTCCGACTTACCAGCTTGTGGCAATTTTTTATCGGTACC
AACTAATTCTTCAATGACGGGGGTGTCGTTTTCCAGCTCATCTTCAGTACAGATGTTTAG
AATTGCGACAAGCATCTCTGTAACTTTTTCACCAACAAATGGCAAGGACCACGTGAAAAC
GTCCATGAAATCTGGTAACCAATAGGGGTGTGGAGTCATGTTGAATTGTCTGATATTCAT
AACATTATTTTCGTATTTCAATATGGCAGCCTTATTATTGTAGGTGTCCAAGTAGTTAGG
CGCACTGAAAAGGGTCAAAAGAGAGGGAAAGCCCAAAGTCTTGGTATTTTTGTACATTCT
ATAACCAGCGTCTTGAGCCTCGTGTGCCCTGATGATGGACAACAGGCCAGTCTCTTGCAG
AAAATGGCACGCAGCACGATACGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1460, 1869..2983
1001..1460, 1869..2980
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved