Saccharomyces_cerevisiae Locus RPS22B
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae RPS22B
Saccharomyces_cerevisiae
RPS22B
XII
snR44
1268..1478
2876
ACTGCAACTATTCTTACAATCTTTCATTTACATGGCTCAAGAAGTGTTGCTGCTCAAAA
TTTCATTCTATTTCATGATTATTTACATTAAACAAGTATGATCCGTTATTCTTCTCGCAA
CCGGAGTGCTCGAGAAGTGCCAGTAAGACGACACCCTATTTTTCAAGTCCAGCATTGGAA
GACTTCCAATGAACACTCTTATCATTATTCTTTATGCATTACGTTTCGCAGTAATCCTAG
AACCCTAACTTTTTCTAAAATTACCGTCAAAAATGACGGACGCAACTTTTCTCAGAAATT
TTTTTTTTCATTTCTCTTAAAAAGTTTTCTACGCTGGATAAATTGTTCTCTTCCCTTTGA
AATATGGAGACGTTCAAAGTCAATTTCCACACATTTAAGGTGAACAAATAAATTATAAGA
TACCACATTAACAACAAGTATGTGGACGAGGTGTGGTAAGATCTCCGCTGAGGTTGATTG
AAAAGTATTGGGTAAATTTGTACTTTTTGTCTGCTGCTGGTCGTTTGTCTTTCGTTTTAA
AATTGCGCTAGACAAGTAAACAGGGATTGCTTAAGAATCAAAGTAGCTTAACTCTAAAGT
ATTATTTTCCTCAGTTGTGGGCCCATGTGTTGGAGGGAAGGAATATATTGAAATGTAAAT
GTTCTTAAGTTCGGTTGAACTTGGATATTGTTACAAGAGTTCTAGTCTTTGATACCATTT
TTACGCAATTACAACCGCATTATTTACCTTTTCATCTTCAGTTTTACGGTTCAGTTTATT
CTGTTACGAAAGAACTATGGTGATTCAAAGGCGAAGTGCGTAGGATTGTAACTCCTATAT
CTTTAGGATACTTACAATTTTGTACTGTTTTCAAGACCACTGTAACCGATAATAAACCGG
AGGACACATTTTAACCCACTATTTTTTTCAGAAGATCAGATGCGAGAGCTCGAAGCATAA
GTATAATACTAACGTTTCAAAACATAGTAATTAGGTAAAAAATGACTCGCTCTTCCGTTT
TAGCTGATGCTTTGAATGCCATTAATAACGCCGAAAAGACCGGTAAACGTCAGGTTCTAT
TGAGACCTTCTTCCAAGGTTATCATCAAGTTTTTACAAGTTATGCAAAAGCATGGTATGT
TCCAACTATTTTTCAATATTTTCACATGTGTTTCAATTTCTGCTTATTTTTAAATGTTAC
CACGAGGTTTGTCCAAGTTCAATGTTGCGCAACTCTAACGAAGAAATAATTATTGCCATT
GTTTTTTACTCCGGGCTGATAACTAGATGGTGTGATCGGGCAGTATACTAATTTATACTG
GACAAAGACTCGTAAAAGATGTTCTTTGTGCTTAGTCCCATACTGTTTTTTAAGTGTCCG
GGATATTTAATCCCATGTGGAAATGCTTCTTACACGGTTATGGATTACACCTCATGTGTA
GCTACTATATCCATTACCGTTTACTTTTCCTCAAAATCTCACTCTTAAAATTTTCAATGG
CAAAATTCTTCCGCACAACTTAGACAACATTTTCTTGTTTTTTATGAAGTAAGCAAAAAT
TTCGAATCAACAACGCTCCATGAGATTCTTCAATACTAACATTTACTCCTTATTTAGGTT
ACATTGGCGAATTCGAATACATTGACGACCACAGATCTGGTAAGATTGTCGTCCAACTGA
ACGGTAGATTGAACAAATGTGGTGTTATTTCCCCAAGATTTAACGTTAAGATTGGTGACA
TTGAAAAATGGACCGCCAACTTATTGCCAGCCAGACAATTCGGTTACGTTATTTTGACTA
CTTCTGCGGGTATTATGGACCATGAGGAAGCTAGAAGAAAGCACGTTTCCGGTAAAATCT
TGGGTTTTGTCTATTAAGTAAGTTTTTAGTAGTGGTACATATATAATATTAATTCTTATA
TCCGTCTTTTCTCTTTGGTTATTTTCTCAGCTTCAGATATTCAAGGAACCGTATTTTTGC
GTAATAGCGAAAAATTGTTTATGTTACATAATAAGTGAAAGCTGGAGGAGCATATGTATA
GAATCGAAGAGAAACCTGAACAATTTTTCGGTATTAGTTACTAAAAGGCTCACATATACA
TGACAAAGAGGAGAAACCTCTTTATGGTTGGTTCTTCCTTCACAATAGATCATTTACCTC
CAGAAATATGGCTTTGTATTTCTAAGCTGGTCGGGACGTCTGACCTGCATAACTTGTGTT
TAATTAACAGAAGATTGTATTTGACAATTACAAGTGATGAAATTTGGAAAAGAAGATGCT
ATGACCGATGGATAAATCGAGAAAGCTTAGATATTTTAACTGGTAATGATTACGATTCTA
TACCCGTCTCTCAATGGTATTCTTACTATTTAAGAAGAGCAAAATGGGAGAATAAAATTT
TTTGTCTATTATGGGGGTTAACTGAAGAAACAAATCCCCAACATTTCAGAGAGAAATATT
TGCATATCCTCCAATTTAGACATTACAAACTGGCTACATTTCTGCATAGGATTATAAAAC
AAGGCTACATACCTGATAAAAGACCACTTGATTTAATCACGTATGCAAACTATCTGTTGA
AAAATGTGCGACATAAGTACGTATTTCCTTTATTTTATCCCACAAATGCCGCTGAATTGA
AAAATCTTAATAATATGGCCTCAAGGGATGCTGAAATGATATATTTAAGATTATCTGCCA
TTGATACGTCTTTTGATGACTTACTAGATGCTAGAGAATTCATATTAAATGGAATATGTT
CCGATCTACTACAAAAGTATAAAAAAATTGAAGAGTTTTTGAAATTACGACCGGTGACTA
GGGTTTCCAAGTTAATCTCAATCAGTACTGACTATCTGGACTGCTTCACACAACCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 1617..1876
1001..1133, 1617..1873
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved