Saccharomyces_cerevisiae Locus TEF4
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae TEF4
Saccharomyces_cerevisiae
TEF4
XI
snR38
1295..1389
3565
TAGATTCTAATGGTATTTCATTTCCCTCATCATCAAAGATCACCTTAATATCCTCTTCC
TCTTCTTCATCTTCGTCTGGTGCTATTATCATAGGATCGTTTACTTCTACGTTCAGGTCG
GAGTCTCCTTCCACTTTTGATGTTGCTTCCTTTTGCTTTTGCATTTTCATGTGCTTGAAT
TTTTCACCAGGTAGGACCACCGGCTTTGCGTCTTTCTCCTTCTTCTTCATTACTTCTAAT
GTACTAGATGTTTCATCATCACGTTGCTCCGGGTCTAATTTTTTCAGTTTATCATTTTTA
CTCTGTTCTTTGGTTTTCTTCTTGGCCTTCCATTGCTCTTGACTTTTTTCATCATAATAG
TATTTTGCAGGAATTAAAGCCAATAAACCATCGAAGGCGCTTGAATTAGCACGAAGGCGC
TCCTCAAGTGAATTACTCATCTCAGTCTCCTATATCTTTCAATTCCCGGACTTTCTTTAT
CACTTGCAACAACGTCTCAGTCCTCACTTGTTATTCATCTCTTGGTCATCTCATCTCTTT
TATTGTACTTTCCTCTTTTCTTTACCGGAGATGAGAATAAAAAGAATTCATTTTAAAAAA
TTTTCAATTTGGTGTCTGGGTGAAACTTTTTAATCGTGTAATCCCAATTAAACCACTCTA
CTTTACTTTAATTGGTACACGAACTCATTACACACCTTTGCCTCTATTGCTTGTGTCAAT
CGTGTTGAGAGAGGAAGCCCAAAACAAGGGAAATTAACCTCTGTAGGCAAGCCATCACAT
TTGGCAATAGCAGCCCTCATTTAATTTAATTCGGCATGTGGCCGGCAGGGTAATGCGCTC
TGCTGCTGACAAAATTGAAAGAAAAATTTTTTTCATCAACAGTTTGCAATACTTTCTTTT
TCATATTTAATTCATCCATTCCGTCGTTAATTTTGTTCAAAACTGGTGTCCATCCTTAAT
ACCAACTCAATTCTTTGATTTTGGCCCTCGATAGATTCAAGATGTCCCAAGGTACTTTAT
ACATTAATAGATCTCCAAGAAACTACGCTTCTGAAGCTTTGATTTCTTACTTTAAACTAG
ATGTCAAGATCGTTGATCTAGAACAATCTAGCGAGTTTGCTTCTTTGTTCCCATTGAAGC
AAGCCCCTGCATTTTTGGGTCCAAAGGGCTTAAAGCTAACTGAAGCTTTGGCTATCCAAT
TTTATTGTATGTTCCATATTTTATTTTAACACTTCCACATACATTGTTTTGCGCGTTTCC
CGTTCGTTTATTTGGCACGTCATTTTTCTTCGAAACATAATGATGAAAAAAAATTTTATC
AAACAGTTATCCCTGTCTGAATGGGTAATAATAGGTAACCTCTCATATGTTGATATTTGT
ATTTCTGATATGTTTCTTAAAGAAAAATGAAAGTCAAAATAACAAAAAGGAAGTACAAAG
CGTGTCCTAATCCAGGAAAAAATATAAAGGATTGTTTTACTAACATTTCTTCAATTAATG
GTTGTATAACCATCGAGATGATGTATATTTAGTGGCTAATCAAGTTGCCGATGAAAAAGA
AAGAGCTCGCTTATTAGGTTCCGACGTTATCGAAAAGTCTCAAATCCTTAGATGGGCATC
TCTAGCTAATTCCGATGTCATGAGCAACATTGCTCGTCCATTCCTTTCTTTCAAAGGTTT
GATTCCATACAACAAGAAAGACGTTGATGCTTGTTTTGTTAAAATCGACAACCTAGCTGC
TGTCTTCGATGCTAGATTGAGAGACTACACCTTTGTTGCTACCGAAAACATTTCTCTAGG
TGACCTTCATGCCGCTGGTTCTTGGGCTTTTGGTTTGGCCACTATTTTGGGCCCTGAATG
GAGAGCTAAGCATCCTCATTTGATGAGATGGTTCAACACTGTTGCTGCTTCTCCAATCGT
GAAGACTCCATTTGCTGAAGTCAAATTGGCTGAAAAGGCTCTAACCTACACTCCACCAAA
GAAGCAAAAGGCTGAAAAGCCAAAGGCCGAAAAGTCAAAGGCTGAAAAGAAGAAGGACGA
AGCTAAGCCAGCAGATGATGCTGCTCCAGCTAAAAAGCCAAAGCACCCATTGGAAGCTTT
AGGAAAGTCCACATTTGTCTTGGATGACTGGAAGAGAAAGTACTCCAACGACGACACCAG
ACCAGTTGCTTTGCCATGGTTCTGGGAACACTACAACCCTGAAGAATACTCCATCTGGAA
GGTTGGTTACAAATACAACGACGAACTTACCTTGACTTTCATGTCCAACAACTTGGTCGG
TGGTTTTTTCAACAGATTGTCCGCTTCTACTAAGTACATGTTCGGTTGTTTAGTTGTCTA
TGGTGAAAACAACAATAATGGTATTGTTGGTGCCGTTATGGTCAGAGGCCAAGATTTCGC
TCCAGCCTTTGATGTCGCTCCAGACTGGGAATCTTACGAATACACCAAGTTGGACCCAAC
CAAGGAAGAAGACAAAGAATTTGTCAACAACATGTGGGCTTGGGATAAGCCTGTTGTTGT
CAATGGCGAAGATAAGGAAATTGTTGACGGTAAGGTTTTGAAATAATCTCAATAACTCTT
CTTCCATATTTTCTTCCCAATATACATAAGAGTCAAACAAAACGAATTTTCAAAAGAAAA
AAGAAAAAAACCCTGAAGTCTACTTCATGATTACCCCATACTTACGCGTGGTTTAATTCT
ATGTAACGATTAACGTCCATGTAATCATTATATATATATATATTGTAATAATCTCTCTAA
TTGAGTATCACAATCTGCTGCGGTTACTCTAACAATATTTTGCATAAACTTGATTCTTCT
CTTCTTATTTCATGTTTCAGTGGGGCATTTTCCATTGTACTTTTGCAACAATAGCGAAAA
AAACAATTTTCCGTAAAGAGAAGCGTCAGTCATAAACGGTGTATGTTACCCGAACTGGAA
TGAATTTTATCTTAAGACTGGAAAACAATTTAGGATAGAACTGAAGATAGTGCAACACGT
CTGGTGATATCATGTGCTTTCAAGCAGGATTTGTCACAGTGCTTTAGAAACACAAACAAA
GGAGGTATATAGAAGTTGCAGTTGCTAGAGTTTGTTTTCTTACCTAATTCTAGATCAATT
CTTTTTTCTGAAAAAAAAAAATGGCTACTGCGTTATATACTGCAAACGATTTCATATTAA
TCTCGTTGCCTCAAAATGCTCAACCTGTTACCGCCCCTGGCTCCAAAACTGATTCATGGT
TCAATGAGACCTTAATCGGGGGTAGGGCATTTGTTTCTGATTTCAAAATTCCCGAATTCA
AAATTGGCTCTTTAGACACATTGATAGTTGAATCGGAAGAACTGTCTAAAGTAGATAACC
AAATTGGGGCTTCTATTGGCAAAATCATTGAAATTCTTCAAGGCCTCAACGAGACCAGCA
CCAATGCTTACAGGACTTTACCTATCAATAATATGCCAGTTCCTGAATACTTGGAAAATT
TTCAATGGCAAACCAGAAAGTTCAAGTTAGATAAGTCTATCAAAGATTTGATAACATTGA
TTTCTAATGAATCTTCTCAATTAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 1532..2565
1001..1205, 1532..2562
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved