Saccharomyces_cerevisiae Locus RPL7A
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae RPL7A
Saccharomyces_cerevisiae
RPL7A
VII
snR39
1746..1834
3662
ACAGATTTAGAAACTGAATACCGTTCAAATGCCAATGTGGATGACGCATATAGTAGAGT
ATTCGGCATTTAAACCTTGGCCTTTGCACCGTGCCACTTCATACACAGTGAAAATAGTCA
CGTAAACCGTTCATGATATCCTTCAATTCAAAATAATTCAGCATTGATGTGCGTCTACGA
CAATCGCTAGTCCTAACTTTATTTTTTTTTTTTTTTTTTACATCTGCCGTCACCCTTGCG
ATGAACGAGAAAAAAACCGCCTTTCGAAGTATAAAAAGGATGAACTCGATATTTCAGCAA
CACATTCTTTACCTTGGTCTTTTCTCATTTTGTTACAAAAATATATACTTATAATAGCAC
AGGTTTTATTATTTTAGATATGCATAACACAAAATAATGTGCGTGGCAGCGTTGATAATA
ACGAGCTAATGTCTTATATCTCATATGAGTTCATGTGATATTTCATGTTACAGCTCAGAT
GCGTAAACTCTCTATCCAAGATGAGGAATAGGATAAAGAGATGTATTTATTTAGTGATGA
TACTGCCGATTCTGGCATTCCAAAAAGTGACTAGCAAAATTGCGATGTTGTCAACTTAAA
TTACACCATCTTTCGGGGCTGATATTTAATACATCTATTTTATCCATTCTTCTACGTATT
ACGTTTGTAGCTTGGCCAAAAAAATATCTTGCATAATTTGTACTCCAGTTCACATCAGTT
GAGTAGAGAATAGCTACTGATCATATAAACACCCACACATATCTATAAATCCGTACCTTT
CCTATATATATATATATATTTTTTCAAATTTTGTCTGAAATTCTTTCTGCAGGTTTGTCG
CTGCCGGACGCGACTTCTGAGAATCATTGCCATCTGTATCTGTATCACTTTGACAACTTC
ATCCTTTCTGAAATATTGAAATAATCAAGACACTAGATCTGCCTTGTATTGTCTTCGGTT
CATATAAATCCAAATAACCAACCAAGCAAATTAAGATCACAATGGCCGCTGAGTATGTAT
ACGAAATCGTCTATTTTATTACTATTTCCTAAAGTATCCAGAGAAGTATACTAGTTTCCG
CAAGTTACGTTGAGAAAAAGGAGCAATTCTGCTCTAATAGCATTTGCACTCACACTTACA
TTTATCTTCAACTTGTGACTATTCACAAGATGATTTTCCGTAGGGGATTACCTTCACAGG
GTCAAAGACAATTTTAGTTGATGAATTTGAGGAAAAATTTGAAATATCTTGATTGTTGCC
AAAAATTTCATCGCCGACCTTGATTAGAATATTTTCTCAAATTTTCATTTCCTAAGTGTC
TCTGTTTCACTCCCTTCATTCGAATGAAAAGTGGTGTTTTCAATTCGATGTAACTTCGTA
GAAAAAAGTTTTACTTGATGGTCATACAAACCTAATTCATTCTATTTTCGGTTATGCTAA
CAAAAATATTTTATTATTTGTATTATTACAGAAAAATCTTGACCCCAGAATCTCAGTTGA
AGAAGTCTAAGGCTCAACAAAAGACTGCTGAACAAGTCGCTGCTGAAAGAGCTGCTCGTA
AGGCTGTATGTTAAACTTTTGCTTACATTTATATTTTATGCTGCAACACATTTTCTTACT
GGGATATATGTGAGTTCACGTGCGTCGCCAATTTTGATAAGTATCATTCGAACAGTTGCA
ATATTCTCAACACCTGTGGTATCATTAGGCTAATGGACTATTTGTTACGTTCTGTTTGTT
TTCTCATTTTATGATGAAAATCCATTGTATCCCAATACATATTCGACTAGTCATTGACGA
TGCTGTCGTAACTTATCACCATCTTTCGACTGATTATAAGAAAAGAAATAGAAAGTAAAA
TAGACCAGAGAGTTAAGGTATTAAGGTTACAATTATTGCCGTGTTTCCAGTGTCAGAAAA
ACCATTGAGTGATAATGCCGTGTAACAATTTTTAGCATAAAATACTGTGTTTTCCATCTG
GTATTTTTTTACTAACATCAATTTACTGTTTTTTACTTTTTATTTTCATTTAGGCTAACA
AGGAAAAGAGAGCCATTATTTTGGAAAGAAACGCCGCTTACCAAAAGGAATACGAAACTG
CTGAAAGAAACATCATTCAAGCTAAGCGTGATGCCAAGGCTGCTGGTTCCTACTACGTCG
AAGCTCAACACAAGTTGGTCTTCGTTGTCAGAATCAAGGGTATTAACAAGATCCCACCTA
AGCCAAGAAAGGTTCTACAATTGCTAAGATTGACAAGAATCAACTCTGGTACATTCGTCA
AAGTTACCAAGGCTACTTTGGAACTATTGAAGTTGATTGAACCATACGTTGCTTACGGTT
ACCCATCGTACTCTACTATTAGACAATTGGTCTACAAGAGAGGTTTCGGTAAGATCAACA
AGCAAAGAGTTCCATTGTCCGACAATGCTATCATCGAAGCCAACTTGGGTAAGTATGGTA
TCTTGTCCATTGACGATTTGATTCACGAAATCATCACTGTTGGTCCACACTTCAAGCAAG
CTAACAACTTTTTGTGGCCATTCAAGTTGTCCAACCCATCTGGTGGTTGGGGTGTCCCAA
GAAAGTTCAAGCACTTTATCCAAGGTGGTTCTTTCGGTAACCGTGAAGAATTCATCAACA
AATTGGTTAAGTCCATGAACTAAACTGGTTGAAGTCACATTACATATAACTACTTATTTT
ATCTAAGTCCTATATAGTTCTGTTATTCACTAGTTTGTATATTGTACCTCTAATTTATCT
TATAATTTCGTCAGTAATGACTTATAATTGGCTTTATTTTCTTCTCTTTTTTTTCACATG
CGCAGAACCTATATAACGAAAAAAAAAAAAATGAAAACTGAAGATAAGCGGCCTTGACTT
CTCTAAACTGCCGATATTTCAACGAAAGTTAGCCAACTTATTTATAAAAGCCTTGAATAC
CAACAATTGGAAAGAAGGTGTCTGTGCTTATCATATATAGCTTGCATAAAGAAAAATTAT
AATATCTTCGAACTTCCATAGAAAGAATATCTTTCAGTGTTAACTGGCTCATTTACTCAG
AAATTAGTATTTTGAAGAACGATGAGTATTCGGAATGATAATGCTTCCGGTGGCTATATG
CAGCCGGATCAATCTTCGAACGCTTCTATGCACAAAAGAGACTTAAGAGTTGAGGAGGAA
ATAAAGCCATTGGATGATATGGATAGCAAGGGTGCTGTAGCAGCAGATGGTGAAGTTCAT
CTAAGAAAGTCATTTTCGTTGTGGTCAATTCTTGGTGTTGGATTCGGTTTGACTAATTCC
TGGTTCGGTATTTCTACATCGATGGTTGCAGGTATATCTTCTGGTGGACCCATGATGATT
GTTTACGGTATAATTATTGTTGCCCTGATTTCTATTTGCATTGGTACCTCGTTGGGTGAA
TTATCTTCCGCATATCCGCACGCCGGTGGTCAGTTTTGGTGGTCTTTGAAGCTTGCCCCT
CCTAAGTACAAAAGATTTGCGGCCTACATGTGCGGTTCATTTGCTTACGCAGGATCCGTG
TTCACAAGTGCTTCAACTACGTTATCCGTTGCTACCGAAGTGGTTGGTATGTACGCTCTG
ACGCACCCTGAATTCATCCCAAAGAGATGGCATATATTCGTTTGCTTTGAATTGTTGCAT
TTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1011, 1471..1564, 2033..2662
1001..1011, 1471..1564, 2033..2659
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved