Saccharomyces_cerevisiae Locus EFB1
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae EFB1
Saccharomyces_cerevisiae
EFB1
I
U18
1194..1295
2987
CTTCATGTCAGCCTGCACTTCTGGGTCGTTGAAGTTTCTACCGATCAAACGCTTAGCGT
CGAAAACGGTATTCGAAGGATTCATAGCAGCTTGATTCTTAGCAGCATCACCAATCAATC
TTTCAGTGTCAGTGAAAGCGACAAAAGATGGAGTGGTTCTGTTACCTTGATCGTTGGCAA
TAATGTCCACACGATCATTAGCAAAGTGAGCAACACACGAGTATGTTGTACCTAAATCAA
TACCGACAGCTTTTGACATATTATCTGTTATTTACTTGAATTTTTGTTTCTTGTAATACT
TGATTACTTTTCTTTTGATGTGCTTATCTTACAAATAGAGAAAATAAAACAACTTAAGTA
AGAATTGGGAAACGAAACTACAACTCAATCCCTTCTCGAAGATACATCAATCCACCCCTT
ATATAACCTTGAAGTCCTCGAAACGATCAGCTAATCTAAATGGCCCCCCTTCTTTTTGGG
TTCTTTCTCTCCCTTTTGCCGCCGATGGAACGTTCTGGAAAAAGAAGAATAATTTAATTA
CTTTCTCAACTAAAATCTGGAGAAAAAACGCAAATGACAGCTTCTAAACGTTCCGTGTGC
TTTCTTTCTAGAATGTTCTGGAAAGTTTACAACAATCCACAAGAACGAAAATGCCGTTGA
CAATGATGAAACCATCATCCACACACCGCGCACACGTGCTTTATTTCTTTTTCTGAATTT
TTTTTTTCCGCCATTTTCAACCAAGGAAATTTTTTTTCTTAGGGCTCAGAACCTGCAGGT
GAAGAAGCGCTTTAGAAATCAAAGCACAACGTAACAATTTGTCGACAACCGAGCCTTTGA
AGAAAAAATTTTTCACATTGTCGCCTCTAAATAAATAGTTTAAGGTTATCTACCCACTAT
ATTTAGTTGGTTCTTTTTTTTTTCCTTCTACTCTTTATCTTTTTACCTCATGCTTTCTAC
CTTTCAGCACTGAAGAGTCCAACCGAATATATACACACATAATGGCATCCACCGATTTCT
CCAAGATTGAAACTTTGAAACAATTAAACGCTTCTTTGGCTGACAAGTCATACATTGAAG
GGTATGTTCCGATTTAGTTTACTTTATAGATCGTTGTTTTTCTTTCTTTTTTTTTTTTCC
TATGGTTACATGTAAAGGGAAGTTAACTAATAATGATTACTTTTTTTCGCTTATGTGAAT
GATGAATTTAATTCTTTGGTCCGTGTTTATGATGGGAAGTAAGACCCCCGATATGAGTGA
CAAAAGAGATGTGGTTGACTATCACAGTATCTGACGATAGCACAGAGCAGAGTATCATTA
TTAGTTATCTGTTATTTTTTTTTCCTTTTTTGTTCAAAAAAAGAAAGACAGAGTCTAAAG
ATTGCATTACAAGAAAAAAGTTCTCATTACTAACAAGCAAAATGTTTTGTTTCTCCTTTT
AAAATAGTACTGCTGTTTCTCAAGCTGACGTCACTGTCTTCAAGGCTTTCCAATCTGCTT
ACCCAGAATTCTCCAGATGGTTCAACCACATCGCTTCCAAGGCCGATGAATTCGACTCTT
TCCCAGCTGCCTCTGCTGCCGCTGCCGAAGAAGAAGAAGATGACGATGTCGATTTATTCG
GTTCCGACGATGAAGAAGCTGACGCTGAAGCTGAAAAGTTGAAGGCTGAAAGAATTGCCG
CATACAACGCTAAGAAGGCTGCTAAGCCAGCTAAGCCAGCTGCTAAGTCCATTGTCACTC
TAGATGTCAAGCCATGGGATGATGAAACCAATTTGGAAGAAATGGTTGCTAACGTCAAGG
CCATCGAAATGGAAGGTTTGACCTGGGGTGCTCACCAATTTATCCCAATTGGTTTCGGTA
TCAAGAAGTTGCAAATTAACTGTGTTGTCGAAGATGACAAGGTTTCCTTGGATGACTTGC
AACAAAGCATTGAAGAAGACGAAGACCACGTCCAATCTACCGATATTGCTGCTATGCAAA
AATTATAAAAGGCTTTTTTATAAACTTTTTATAATTAACATTAAAGCAAAAACAACATTG
TAAAGATTAACAAATAAATGAAAAAAACAACGAAATAACTTAGGTTTTAGGCTAAAAAAA
ACAGAAGGAATTTTGAACGATAAACTTTTCGACTGCACACGAAACATTATTACTAATTTG
TGTAACCACTATATAAGGAATCGTGTTTATTAATTGAATTTATTCCGGGAATATTCAAGT
TATGTATATCTCTTTTCATATTCTTAAATACACATACTCATAATATCTTGTCGAAAATAC
GCGGTGTAGGGAGTTATGGTGGATAACTTTTTCACGATTAGAAGAAAAGGAAAATTTCAT
TATTCGTAGCTTAACATGGCAAAAACGAGAAAGACATATAATCAAAACGTGAGTTTCCTG
TGGAAAAAAAAAAAAGGGAACCTCTGGTTACGATGATATACCTGCGTGAAAAAGGACAGT
TATTACCAATACATACAAAGGCTTAATAAGTGTAAAATATATATCTGCCGAGACCATTAC
TCATTACACCTAGAATGGAGCAAAATGGCCTTGACCACGACAGCAGATCTAGCATCGATA
CGACTATTAATGACACTCAAAAGACTTTCCTAGAATTTAGATCGTATACCCAATTAAGTG
AAAAACTGGCATCTAGTTCTTCATATACGGCACCTCCCCTGAACGAAGATGGTCCTAAAG
GGGTAGCTTCTGCAGTGTCACAAGGCTCCGAATCCGTAGTCTCATGGACAACTTTAACAC
ACGTATATTCCATCCTGGGTGCTTATGGAGGGCCCACGTGCTTGTATCCGACAGCCACGT
ATTTTTTGATGGGCACTTCTAAAGGATGCGTACTCATTTTTAATTATAATGAACATTTGC
AGACAATCCTAGTGCCGACCTTATCTGAGGACCCTTCTATTCACTCAATAAGAAGTCCAG
TGAAATCAATTGTCATATGTTCCGATGGTACTCATGTAGCTGCCTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1447..1987
1001..1080, 1447..1984
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved