Saccharomyces_cerevisiae Locus Mono:44:snR5
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:44:snR5
Saccharomyces_cerevisiae
Mono:44:snR5
XV
snR5
1001..1204
2204
CGGTGGAATTTAGAGCCATCATTGAAAAAGTTAAGCAATTGCAACACTTGAAAGAGGAA
GAGTTTAACAGTCATCATGTTGGTCATTTCGGTCGTAGAAGATCTTCCCACCATCATGGT
AGACCAAAGATTAAGCACAACAAGCCTAAGGTTACAACCGATTCAGATGGTTGGTGCACA
TTTGAAGCCAAGAAGAAGGGTAGTGGAGAAGATGATGAAGAAGAAACAGAAACCACACCA
ACTTCTACTGTGCCAGTTGCTACCATTGCCCAAGAAACTTTAAAAGTCAAGCCAAATAAC
AAAAATATTTCTTCCAACAGACCTGCTGATACCAGAGATATTGTTGCGGACAAGCCAATT
CTTGGTTTCAACGCATTTGCTGCTTTGGAAAGTGAAGACGAAGACGACGAAGCATAAGTC
ATTCGCTCATGCTTTCTTCAGGCAGCTGTACGTGTACTATGTATAAATTTTGAATAACAT
TTTTTTTAATAAACAGTTTTTACTCTTTTAGGTTACTTTCCAGATTGAAAATATACAACG
TGGTTACATAAAGAAATTAAAATGTAGAACGAATCATGACCAACTGTATCAGGTGTTTAA
AAAGGCGAGGTGAAAGAGAAAGGCTTCCCCCTCTAATATCAACAGCTGGAGATACATCTT
TCTAATAATTAATCTACCATGAGCCGTACGCACTGAAGCAACGCCCATCAAACATCCGAA
GCCACATTATGAGTACAAAAGAGGCTGACGTTAATAGGAACTCATGGTGTAATTTTGCTT
CACTTTTCTGAATTCAAATGGAAATAGAAGTAAAAATGGGCAGAAAAGTTACCTCATGCT
TTAAATATACTCAACTTTTCTCTACCGACAGTAGGAGCCCTAAGAGATAAAGCGAAAAAT
TTTCACAGCGCGCTCCTTGGTGCGGCGAGGGTATAAAAGGCGATTTCATTTCAATTCTTT
GAACTTACTTCATTTGCAGGATCCTTCAGGATAAGAAAACCATCATTCAATAAACTGATC
TTCCGGATTACCATGCTTAAGACATCACGCCTCCATATGTCTATATAAAGCGCAAATGGC
TGGAAGTAGACCAATTTTTTTTGTTCCTAGCTTTTCATTATTGAAATCTAATCCAGTTTT
AATGGTTTTTCTTAATTAAGAAAACAAATTATCATTGGTTCGCTCTAGGTGTACATATCT
TCACTTCATTACTCTCTTGTTTACATTGTATACATCGTACATATACTTCAATTATGGAAA
TACCATAAATTCTCTTAGTGTGTAGTTCACTAGTTTTTGGGGTTGGGTTGTGCTGTAGTC
AGCTAAGGCGCTTTAGTGAACTTTCTAGTGAGTTTTTTGAATTTTAGTGTCAAAGGATAA
GGAAACAGAAAGGTAAAATAGACCTTGCTCGAGAGATGTCTAGTCGTAAAAAAGTCAGAG
TATTACTGCTCAAGAATAAAACTGTCCCCATTGATAAATATGAATTGGAGTGTAGGAGTA
AGGCGTTTGAACCCATATTCGTACCGCTTATTAAACATACACATGTAATTCAAGATTTTA
GAAATGTTTTGAATACCATCCCAAACTATTTGAATACTATCAATTACATTATTATTACCT
CTCAAAGGACTGTAGAGTCATTGAATGAAGCGATCATTCCCACATTGACAAGTGAACAAA
AAGCTGCATTGCTCAGTAAAACAGTTTATACTGTAGGCCCTGCTACTGCTAACTTCATCA
GAAGATCAGGTTTCATTAATGTTAAAGGTGGAGAAGACGCTGGTAATGGTTCAATCCTTG
CTGATATAATTATTGATGACTTGAGTACGGATATTAAGGCATGCCCACCAAGTGAACTAT
TATTTCTCGTGGGTGAAATTAGAAGAGATATCATCCCAAAGAAACTCCATAGCAAGGGAA
TAAAAGTAAGAGAAGTGGTTACTTATAAAACTGAAGAATTAAGCGACGGTTTTAAAAGAT
TCATACACGCCATGAAAGAATGCGATGAGGATGAAGTATTCTCGGACTGGGTGGTAGTTT
TCAGTCCCCAGGGAACGAAAGAAATTACTCAGTATTTGGGTGACAGTAACCGCCTACCAG
GTTCCCATCTACGGGTTGCGTCCATCGGACCTACCACTAAAAAATATCTGGATGATAATG
ATGTAACCTCTGATGTGGTCAGTCCAAAACCGGACCCCAAGTCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved