Saccharomyces_cerevisiae Locus Mono:41:snR35
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:41:snR35
Saccharomyces_cerevisiae
Mono:41:snR35
XV
snR35
1001..1204
2204
CACATATACCTAAAAGCAAGTCTTTGTTGTGCTTTATGTTAGCGATCGGCACAGAGTTA
AACCTGTCTTCATTGCCGCCTCCGGCCCCATTCCCCTGAGCGGTCCCACTCCCGCTTTCC
ATCCACTGTTCCTCCAACTGTCTAATGTCATGGCCCTCATCATCTCTGTTGCCATTTTGA
GCAAGTCTCTCCTCCTCCTCCTCCAAATCTCCATACGTGGCCCGAAACTGTTGCCTCAGC
AGTTCGATTTCTTGCTCAGTAAATCCCACGGATCGTAGCCTATCAAACCCGATGGCCTGC
GTGGTCATGGAGTCATTGGACGGAGTTGCATCGTCCTTTAGATCTTCGTTGGCTAACTCT
GCTTGTGTCAGCTCCTCTGTACCAATTATACAATGAATATAGTAGTTGTTCTGCTCTGGT
GCCACGCTGGTGCCTGTTGCGACGTTAGAGTTATTAGCAGTATCGAAGTAATGCGTCAGT
TCCTCAGCAATCTTGGAATGCGTATTCAGAATACTCCCGTTCCTTATAAACTTCAGTCTT
CTTTTTTGTGTTTGTTGGGGCCTCAATTCTCTACACATCCGACGTAGCCAGTGGGTATTT
ATATTCGAAAATGGTACATTTGATATGTTCAACTGCAGATCCCTTACTGATACGTCGGAA
AACCGTATCACAATGAACTTCTGATCTGGGGACCTCACTTCCCCTCCCTGCGATCCGTTA
TGTGTGGGTAATAATGGTTCTGCGGACATAATTTTATCAATGTATGCTGCCTTTCACCTC
TCTCTTTGCTTGGTTTATATCACAAGCGTCTTCTTTAATAACTCAAGGGACCCTAATACG
CCGTTCTTTATATTCAACTCCGGGTAATGGAGATAGTATATATATATTTTTTTTTCCTCC
CAGTGCAACTATAAAAAGAGATGAAGAATTTCTAAAGAGTACTACCTCGGTTTTACTTCT
TGTATATTTACTCTTTTTATTTCAAATTTTAAAAAAAAACCATACAAAATTAATCGTGCG
GATTAATAATCCAGGACTATAAAACCGTGTTGTTTATATCGAGTCTCTTTTGGTATAAGC
GTCAAGTCCATCGGAGAGATCATCATTTTGTTCATCTTAATGCCCTTTTGTGTAGGAAAT
TGAGGGAAGTTTAGGCTTCTCAACATTTTAAGACGCCTATGCAAGGGCTGGTAGGACAGA
CATGCTATTCTTATTTTGACGTAGAAATAACGTAGTTAAGATTGAAGAGGAAAGAGGTAT
TCTATATACAATAAATATCAGTGTCCGTACTTCAGATCCCTGAAAAAGTTCATCATACCG
GTAAAAACCACCAACATTAATGAACCACCGGGTGCTAGTCTACATACTTTGGGGACGAAA
CCTTTGTACAATGCTCTGAAGCCTTCTTCACGGTATATGACCAATAGCGAAGGTAGGCAC
CAGTTGTATTTTTTAACAGCACTGCTGACCGCGTCCACACTTTGGATTCTGGATTTCACC
ACGTCAAAGGGAGTGTTAAGCATGGTCCCGACCGTACCACCGATCGCACCTGCAATAAGG
TCATTTCTGGTCTTTTGTCCCTTTGTCTTTGCTACGGGCATGGAATTTCTCACTTGGTAG
ATAACACCGAAGTAGCCACCATTCCAAAGAGCGTTTCTCCACATGGTAGATTCGATACCC
TTGTATAGCCCCATAATACCTTCGTTTTTGATTGTTTTTTTCAAACAGTCCATTGGTCCA
AGATAGCTGGACTTGACGTCTTGCATCCTGATTTTGATCAATTCAAATGGAACAATAACT
GCAGCTTCTGTCATACCAGCAGATGCACCAGCCGCAATGGAGATCTTCTGCGTAGTTTCA
TTCGTGTTGAATAGGTTTTTGAAGATTTTTTGATATTGATCGTTACATGCAAATTTGGTG
GCTCTCTTTGGTGCTTCCATCAACATTGGTGAACTAATACCTCTGTAAAGTCTGCTAAAC
CCTTCCTTCTTTACAATTTTTTTCAAACAATCGATGACACCATTATATCTCTCTACTTGC
TTTCCTACTGCAGCGGCAGTAGGCGTCGTCACCTCCAGTTGAAATCTTGTCTTAACAACA
TCAAGCGGATACATAACAGTTAACTCAGAAATACCGGCGACGGCACCTGATATGAACTGA
TATATAAAAGGCAATGGCTTTGCGTTTGAGTCTGATGACATATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved