Saccharomyces_cerevisiae Locus Mono:17:snR46
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:17:snR46
Saccharomyces_cerevisiae
Mono:17:snR46
VII
snR46
1001..1197
2197
TTAGGATTAATAGTTTTATATGTATAAAAATATTTAGTCAGTATTTAGCTAAAAAGTTT
ACTTTCAAAGAATTGTCATGTTTGCAGCTAGTGCCTCTGGTCTTTTGAGTATTCCCAGCC
CTTGTTTAGAGGTCATCAAGAATGAACTTGAAATTAGCCGTATCAGTGGTATTAACCTCT
TCTAAGAAGAGCAGAAAAAGAAAAAAATCTCCGCGACGGGGAATTGAACCCCGATCTGGC
ACGCGACAAGCGCCCATTCTGACCATTAAACTATCACGGAAGAAATATCTGTGAAATGTG
ACTCTTATAGCATACTATTTTAGTTATGAATTGTGAAAATCCTCCCTGTCCTGCGTTCTA
CAATTTATTTAGTACTTGTTTGGCAAAAACGTCTCTCAGTGCCATTTACTTTGTAAAAAG
TGCAGACTACATCGCATCAACGGTCATATTAGGAGCCACTTCTATTTTTAACTCAACATG
ATCATTCAAAAATGTCGATACACTTGCATTTTATTGTACATACTAGTTGGAAGAGGCAGC
GTCGATTTTGCTGAAATTTCTAGTAACTTGTAGCAGCAATACATTATATCATAAAAATAA
CCTGACTTGTAAAAGTTGAAACCCTAACTTTTATTATTTCTTTCAATATTTTTCGATTAG
ACGTGAAAGATGACCAAGCACAACTAACAAAAAATTTGCATCCTCATAAAAAGCAAGACT
TTTTGTATGTCGAAACAAAATTATTAAAAAACACGCATTAACACAGACACGAATTTGGCA
TACTTTCATTTTACTTTATATCTAGTGAAAAGTAGAAATTGTTTAAGGGAACTACTTCAC
AGTGACCACTGATACTAGAATATGGAAATAAGAAAAGTTGCTAAGTAGGAGCCTAACAAT
CTTTTTTTATATTTTTCCATATTCCTTTATTGTCATGGGTCAAGACTGTATATGTTAGTG
AAAGTTTTAGGGTTCTTGTGACAAACTTCACCAACATAAACATGGCCTCTTCGAAGATCC
GTAGATTTTGCATTTTTGCGGTGGTTTATGGATTCAAAGCGAGGCCTAAATTAACGATCA
TGTCTTTGCTATTATATCAGAGGGCATATCATTGAATTTCCGATTTCCAAAGGGAAGAAA
ATAAATAAAGTTGTGCTATTTCCATGCATCCTTTTTTCTTTCATTCAATGACACATACTT
CTTGTAGTAGGAACAATTGGTAGTTCTGATATCGATTAAGCCTTCTAAAAATGCTTTATA
TTATAAAGTACAAATGCAAGAAGTAGCTATGGATGCTAAAGAGCTGGTCGATTTATTGTT
TGGTGAATGAATGTAGGTTTAAATCAATGATCTCTGAATCAGAAACAAGGGTGACCAAAA
TTGGAACCTTGAGCCTTTCTTCCTGTAGTTCATTTCTGCCTTCTCTTTTTATATCGAACG
ATGTTAATTTATTCCACTGATAAATTTTCTTATTGTTCTTAATATAACCCTTTTTAAATA
TTTCCAAAATACTTAACATTTTTTGAATATGTGGACCGTAAGAGAATATACAAACTACTT
GTTGTAGACCCAAACTTCTATCTGCCATGTTGATTTGTTTATCTAACTTATTTACAGACT
TCTTAATGTTATCGTTCTTCGATATGCCATGATACTGTATTGATGTACTGTTGTTACCAT
TATTTGCTAAGGACGGTATAACTGTTTCTTTGAGAAACCGAAGACATTGAGTGGAGGAAG
AGATATCCAAATCTCTACTAATTTCATTGTAATATACGCCATTGATCATTTTGATTTGCT
TTTATCTTTTTTTCTTCTTCTTCTTTTCAATCTCTTCCAAACAATCTTGGCCTCATCTTC
ATGGAATTTTTCGAAATACTCATCAGCAAGTGTCCGATGCCTTCTCAATTTTTTCCAAGA
GCGTGCGGGGGTTGGTTATCCAGTACATGTGTTGCTTGAAACTGCCAACAAAAAAGAAAA
GAAAATAAGAATATATTAGTACGCCAATAGTAAACGTCACCCCGAGGTTTAAAAACTAAC
CGTGATATACGAGGAGAATTGGTAACGGTACAATGATGATACTGGGTAAAGCCGGGATCC
TGGCACAGTATGGGACAATATATGTGAGACAAAATACCATTCGGAATAATTTAAGTTCCT
GCATTTTTAAGCAGTCACTATGTGCCTTTCATTCATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved