Saccharomyces_cerevisiae Locus Mono:50:MRP
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:50:MRP
Saccharomyces_cerevisiae
Mono:50:MRP
XIV
MRP
1001..1340
2589
GAATAAACATGCAACAGCGATAATATGAGGAGGGTAAAGCAAATGAACATCATTTATAT
AACTGTCGTTGATTAAGGACCAACAGTTTTGTAGATCATCTGACGATAGTGTTATTTGAA
ATGGCGGTTGCTTTAAGACTTGAACAATTTGCTTTAAGGATTGATAAGGGTGGTGGACAA
TTAAGTAACTTTCCAATTCTTCTAGTAAGTAGAACTCAAACTCAGTAACTTTAGTAGGGT
CAGGAGGAATAAATTCGGGCCATAAGGTACGGGCTTCACTTACCAAAGTTCTGATATATT
GCGGGCATTCTTCAACTTTGCATGCTAAATATACACACGTAGTAACCAGCATATATAGGT
TTATTTCTCTAACTGAAGCCTTTATTAAAAACCTTGATAGATAAATATGTGCTGTAGCCA
GTGCATACTGTCTTATATTTAGTCTCCTTCCAAGCTTCATTATCAGGAAATAGCAGTAGA
TCCTTAGATTATAATCTTTATCATAGTGTAAGTCTCGGTGAGTTATTGGTATATTCTTTG
TGATGGATTGTTCGATGCCGTTTTGCTTCGAATCCATTACAATATTCAAACCTTGAGGAA
ACAGCTGGCACTCCAATAGCCATAACTTCTGCCTCTCTTTAGCCAATGATGCCTTGGTAT
ATTGCCAATGATGCCTTTGTGTAGATGTCCAGAAGCTCCCCGACATGTCTAACTTTTGAG
ATTCAGATGCCTTATCGCTCTTCAACTAAAGTTTGAGAGGGCATTTTTTGTTCGAACAAT
ATGAGTGCTAACAAGGTTGCTACCACATCAATGAACTCTACTCCTGTATGAACCCTAATT
TTCCTTCATGAAAAATGAATTTTCGATGTTTTTCCGTGGATTTTATATTTTTTCAAATAT
ATAAAGGAGTAAGAAAATAACTTTGTTTATCCTATGTTGCGGTAAAGAACTAAATAGTGG
TCTTCACCTGTTTTCTAATTTCTTCTCGTTTAAAGTTCTTCAATCCATGACCAAAGAATC
GTCACAAATCGAAGCTTACAAAATGGAGTAAAATTTTTTTTACTCAGTAATATGCTTTGG
GTTGAAAGTCTCCCACCAATTCGTATGCGGAAAACGTAATGAGATTTAAAAATTTTAAAT
TGTTTAAATCAACTCATTAAGGAGGATGCCCTTGGGTATTCTGCTTCTTGACCTGGTACC
TCTATTGCAGGGTACTGGTGTTTTCTTCGGTACTGGATTCCGTTTGTATGGAATCTAAAC
CATAGTTATGACGATTGCTCTTTCCCGTGCTGGATCGAGTAACCCAATGGAGCTTACTAT
TCTTGGTCCATGGATTCACCCCTTTTTATTTTTTTAACAGTTTGTTGTTTACACTACTTT
TTAGCAGTGTAAAACTTTTGCATAGTTAAATATGCCGAACTGATCTAATAAAAAGTCTGA
ATAACTCAGATGAGTTATTTATTGGTAAACTTGTGTAAGAAGAAGATGGAATAGTGAATA
ATTCATCAAATGATGAAATACCAATGCAACAGAGTCAAGCTCTGAGTTTCAAAAAGAAAC
ATGGACGAGATTGCTTTTTTATTACTGACCATGATTATTCATTACTTACCATTGTTCCTC
ATTCTATATAATTGATTGGGCACCACGTAAATTCTTGAGCCTTTTCGGTAGTATTCAATC
GCAATATGGGGTAGTTTACGGAAGTGCTGTAAATGATGTCTAAAATGAACAACTATGCGT
CCTTATTGTGACAATGAATTCCCTTCTTAAATCTCTATAGAGGTCGAATAGATGAATACT
CAACACAAAACACTATAAAATAAAAAAAAATACAAAAGTGTTTATATTTTTGCTGTGCGT
GCTAGCTCATAGCACCCTTACTTGTACGCTATCAGACGATAGAATTAAAGAGACACTTCG
TCTGAATCCACTTATACTCTTTGTTTTAAAAGGTACTGCACCTTCTATGACCTTGATTTG
CGTAACTTTAAATCCATATGACTAAGTATCTTCCAATCAGCTGTTAAATTGACTGATGGC
CATCAAAATACATGCTAAACTAACATATGGACTGGCCCTTTCACCAACACGTGCCATTTT
CCAGAAGGCCCCCAAAACCTCATGATTTTTGTAACGATCTAGGAGAGACGGCCACTGCCC
ATGAACATAAGAACATGAACAAATCAGTAACAATATCACTTGCAGAAGAGAACGAAAATT
AAATAATGCAGACATATTCTGTCGTGGAAAAAGGACGCAACTTTGCAAAGTAAATCGATC
CGGCTCTCTAGTTATTTTGCAAACGATGTTTACCGCTGTTCTGTCTTTATCCTTGAGTTG
TCGTTGCTCACTCTATTGAAGATCAAAATTTCGCTCAAGAAGAGCAGTCCCACCATGCGT
ACACCACACTACAAAAATGAATGTTATATCGTTTTTTCATGAATTACAAATGTCTATCGA
AAAGTTCATTACTAAATATAATAAGATCAGGATCATTAAGAGATAAATTCACTGTGTCAG
GTTACTTCCTGATAAGCTGAAACAAGTGGGTTCTTTCCTTAAGATAATGTTCAAATTTAC
TAAAATCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved