Saccharomyces_cerevisiae Locus Poly:6:snR51
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Poly:6:snR51
Saccharomyces_cerevisiae
Poly:6:snR51
XVI
snR41, snR70, snR51
1001..1095, 1193..1356, 1437..1543
2543
TGCACTTTCTATAAATTTGAAGATGGGGTTTATGATTAAGAATGCTATCGATTATGTGG
GGGCCGAAACAACTAACGAAAGAAATGAGGACGATACAGGGGAGCAAGACCAAGAAATAG
AATTTCTCAGCGAAAGGCTTAGAGGTACGCTGGTGATGGATACCATTAAGATAATTCAGT
GCAGCATATGCGGAGACACAGATGTTTCTCGATTAAGCCTGTATTGCCAAGACTGCGAAG
CAATATATCACGAAACATGTCTACGCGGGCTAGCTTGTGAGGTGGGCGATCGCAATACGT
GGCAGGAGTGCACAGATTGTAGATCAAATGCATTGCTCGAGCTGCGCATGGGTGCTATCA
GTAGCCAACTTGCTAGCTACGATTCCAGGAATTCCATGATTTTTGCTGGTGAGTTACGGG
ACAAGCACAGCGTCAAGACACAGCAGATGTATGAACAGATACGGAATGCCAAGCACAAAA
TCCAGATGCACGTGCGACGAGCACTGGACCGGTACCCACTGCCTCTGCTGCGCTTCAAGG
ATGCCTACAAGCACGTCAACAAGCAAGTATCCCGCAAGTTGTACCGTCTCTCTGACAACA
AGTACCTGCCTGACCAGTACGATTACGACTCTTTAGCCCGAACTGGAGTGCACACAGAAC
TCCTAATTTACTGTCATGATGAGTAGTAATGCAATATAACATTAAAACAAGATATAAACA
GTATAATACTCTAGTATGAGCCCTAAAAAAAACCCTCAGAAGCGGGTGACCCATCTCTCG
TACGACGTATAAAAGCACAAGTTTGACCCATAGAATTTTTTTTTCACATCTTCCTTTGTT
TGCTTCTTCGTCTTCAATAGAAAACAGTTGAACAAACTCAAATATAGCACCATTGTGAGT
GCTACTGCACTACAAAGAGGCAGATTAAGCGACCAGTAGGTCCCTTGGAAGAGATAATAT
ATGAGTTCCTTTTTTCTTTTTCCATTTTCTTTCTGTGTGACTCCCCTATGATTAAAAATT
ATTAATCATATACCAATTGTTCCGACTGAATAGTGGTTTAACTACATGTCGACAACCCTT
TTTCGTTAAGTTTCAGCCTTGTATGAGGGGTGCCACGGAAGGGAAGAAAAGAAAGCATTT
ATCTTTCATTATTATCTTTTTCATGCCTGCAATGGAATTTTTAATTTTCCTTTTGATATG
ATGATTTGTTGTCGACCGGGCGGACATATTAGTATCTGTTAAAGGGTCGCCGTCTACTCT
CATCGTTCTTTTGTGTACAAATTTTTTAAAGGAGCGATGTTGATGGCATTATGGTTCTTT
AGTGGAGAATTGATGATTGGTCACAAGACATCTGATTTTTTCGGAAATTTGTTTCTTATT
TCAATTTATTCCTTATCAGTTGATTTGGATGATAAAAGAGACTGTTGCGGACTAGTTTAT
TATGATGATTTTTTTATATTCACACTGTACTAGATTGGTCTCTTTAACGAAGGGGCTAAT
TGATGACTACAAAATAAAAAATAACTGATTTAATGACTCTGAAAAACTAGTTCTACAACC
TAACTAATCTTGCACCCTATGTAGCCCTTTAAATAACTCTTGGTTCTCTTCCCTTTAGAT
CTTTCATTTTTGCACCTAATTGGTATGGCACATTTTTCAGTTTTCTCCCACTTAAGTTTT
CTCCGTAAATCCCTCTTGTATAATAACCAGGAGAAAGGGTTTTGAACACATCGAAGAGCA
GAACAGCAAGAGAAAAGTAGCATTAAAAGACCATAATGGCTAGCTTGAAGGTATTTCTCG
CAGTTTACTTGCTTGGCGGTATCACATTTTTGCCTTTGGTCCTTTTCACCCTCTATAAAA
TCCATTTATTGTACAGTAACCTTAAATCGGCATCGAAGAAGGAGCTAGATCATGATACAG
CAGACGAAATTGATGAGAAAACCAGACTTCTGGCTCGCGATATAGACCCAGAGTTTAAAG
CACGCAAGCTAGAAGAGCAATTAGGTGTCAAAGTTTTTAACAAGGGTTGGATCACCGTCA
CTAAGCAATATTATTATCATTCTTCAGAAGTGGCTGTAATTTTGAAGAATTCTAATAATA
ATAAAGATTCAGACACTGCACTTCAAGAGCAAATCTTGCAAAGAACAGACTTGAAGAAAA
AACAAAGGTTTTTTGCAGTATTAAGACATGGAAATTTGTTTTTGTATAAAGACGATTCTC
AAAATGCAAATTTGGTCCATGCTATATCTTTACAAAACAGATTTATCACCATTTGGCCCC
GTTTCGATGAACTGGGTAAGGAAGAATTGCCAGATGCCTCGCTTTTCACTAAGAGAACTT
GTATTGCTATTTTCAAGAATGACCTCGTTTCTATAGACTCTAAAAACCATAATGTTATCC
TGCCACACTTCGACCCACTTACCAGTGCTGAATCGAATAACGGTGACATCTCTACCAATG
ACACTACACATGAATATCAATCACAATTCCATAGCTCAAATCAGTTCTTCTTGTATTTCG
ATAATAACATGGACAAAGAAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved