Saccharomyces_cerevisiae Locus Mono:26:snR87
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:26:snR87
Saccharomyces_cerevisiae
Mono:26:snR87
XI
snR87
1001..1109
2109
TGGTAACGGATTGGATATTTGCCAGCACTTTTTCGTAGCCTAAATCTCATTCCTCGTTC
ATTTCCCTCCTCAAATCGATGATAGGTTTTCCGGATTTAACATACCTTCTTTTGGTCAAT
AATTTCGACGATAGCGGCCAATTTACCTGCGGATTGACCCTTCTTGATCAAAACCACACG
GCCAACTTCGACTAATCTCCAGTTAGAAGCCTTGACAATAGAATCGGTGGACATTGTTTA
TTTTATTTTTCACGACTCTCTTTGTTCACTAAGACAAACAATTAAATTTGTTATACAATC
GGCAGACCTGATCAACTTAACCTTAGATTACTTTTTTTTCAGTTCAATAGTACTCGACGA
GTACGAAGGGCAGTCCACTGAAAGCTCTACGCTCTCTCCGTTGCCAATTGGGCTGAGAAT
GGAAACACTGCGCGCTGAAGGGAAACCCGATTATGGAAAAATGCACGCAGCTGCAAGCAG
CAATCTCTCGTAAACCGCTCTTTTCCGGGCGGAAAGTTAGGCCGACACCTGTTTGAAGCT
TCATAAAATGCAAAATCGAAAAAAAATTGATAACGGACACTCAAAATTTGATATTTCACA
CATATTATGTATGTGATGTCAAGATGTAAAAATAGTGTATGGGTGTATTTGCGCTGTCAA
TTATTTTACTCAGAGTATAGTTACATTCTGGCAAGAATTTGCTGGTTTTGTCTTTTTTTA
CTTCACAACTAATGCTGGATTTTTTTATTTAAACCTAATTTCTTCAGTGAACTCCAATGT
GTATTCATGTTTGATTTTAAAAGCTTCAATTTTAAAAGCTTCAATTTTAAATATCCGATG
ACTGTTAATCGCAGCTGCTAGTGAGATGACTGACAAAAGGTTCAGTAGAAACATAAAATA
TATAACAAATGTGTTGAGAATGATAGTATGATACAGTGGTATCATATTTCGTTCCTATTT
GAGGTACCAGTAGTTCTTATCAAGAAGATTCAATGAGAAAGGTAACTGAATGATGATATA
ATTTGCGATCTAGGGCTAATCACTTGGAACACCGCCATGTTCTATATGGGTGATTAGCGA
AGTGCGAAAAATTTTTTATCTGATATTTTCCTTGAACAATATTTCTAATAACACTTGCGT
TGTTGCAACTGGCAGATTAACCATGTTGCTCAATATTCCTTCCTTGTATATGGGAGAACA
TCTTGAGGCAATGTTTAGAATTTAAAAATGTGTGCTCCCTTAAACTACGCTACTCAGAAA
GGATCTTCGTGTGTACGGTAACTGACCAATGAATATTGTGCGGTAAGTATCTTATGTTTC
TTGTTGCTGAATGTACGGTTCATGCAGTAAATTAGCTACTCTAGTTTTCTTGTTATTGCA
AGAAGCCGCGCATTGCTACATGCAGAAAAAAAAAGAGGAAATAATATAAGGTATATCATT
AAGAAGGATACTGGAAGAACTCAACAAGGAGAGAACGGTAGAAAGGTAATATATAATCAT
CATAGCGATGTCAAATTCTAGGTATTCTCAGACCGAATCAAACGTATGTAAATCACCGGC
AACACGCATAGGTGTTTAGAATGGGACCTAGCTTGCTATATGGATGTTATAAGCTACTAA
CTATTGCTTCTGTACACCGGATGAGCAGATGTATCATCCCTTCATGTACATGTACTTTAA
ACAGAATGATAGGAAACTAGAGGGGTTAGCCAATAAATTAGCTACATTCAGAAACATAAA
CCAAGAGATTGGAGACCGAGCGGTCTCTGACAGTTCTGTCATAAACCAAATGACAGATTC
ATTGGGATCGATGTTTACCGATATCAAAAATTCGTCCTCAAGGTTAACCCGATCATTAAA
GGCTGGTAATAGCATATGGAGAATGGTGGGTTTGGCGTTATTAATATTCTTCATTCTATA
TACCCTGTTTAAGTTATTTTAGTGAGCCAATCAAGCCAAAAATAAATAATGTACATAGAT
GTATTCAATTTAAGAAATAGGAAGAGAATGGAATAAGGCAGGCATGAAATTTCATTTGCC
TTCTGCCGCATTCTTACCCAATCTATAACTGCCAATCGCACTACCCCAGTTAATTTTGGA
TCTCGTGACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved