Saccharomyces_cerevisiae Locus Mono:35:snR40
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:35:snR40
Saccharomyces_cerevisiae
Mono:35:snR40
XIV
snR40
1001..1097
2097
GTTTGATACTGAGTGCTAAGTTTCACAATGACTCTTCTCCTTTAAACAAGCACTGGGCT
AGGTACACCGATGGTCTCTTTACACTAGAGGATATCAACCTTATGGAAAGGCAGTTGTTA
CAGCTGTTGAACTGGGACCTCAGGGTGAACACAGAAGATTTGATCCTAGATCTGCAGCCT
CTATTAGAGCCCATCAAGCAAGACTTGGCAAGATCCAGCGACCAAAGGAAGAGAATTAAC
ATGATGATGTCCATGAACAGAAGGACTTGTGCTGGCACGAGTCCTATCAGATCAAACAAC
AGATTCAAACTCTACGAAAAACAGAGAAACGTGTCGATAGCATCCGATTTAAGTTCTGCT
ACTCTAGTCGACAGTTGTAATGATCTAAGAAGGCTAAAAGATGTAACCAACATAGCGAAC
AACACAGTCGCTAACACGAATTACGTCAGGACGGTAGAGAAATGGAACGACAATGTCAAC
AGGCAAAGTTGGGATCTGGAACAGATCATGAGTCAACATGGGTTTTAATGTGGTAAACAA
GATGGCCCTTACGGGGCTCTTAGTGGGAGAAAGATTTTTAATAGAGCATAATTAACGGAT
ACATAATATATTATAAATTTAAATAATCAAGGATACCTAATAATAATAACAATCAACTGA
ACACAACATTAAAAATGGTATTTGTTATTGTATGTTAAGCCCTAAGTGATTGTGCCGTTA
TAACTTCCATTCGGGTGATACCTGCAATATGAGGAAGAAAAAAGATAAATTTTTTCTTCT
TAAAGTATAAAAGGCGGACATATTTGATTTAAATGCAGAAGTTTTCTCTCAGTGGTTTAT
GTTTTACATATGATAGAAAAAATGAAGCAATAGCAAAGTATCGTAGTGCGAACCGGTCTC
GTAACTTTGATAAGTTTATCAAAGGCGTTAACATTTTGTTTCGTAATAGTACCTTAACAC
ATGACGAAGATGAAAATTAAACATGAATTCAAGGAAAAATGGTAAATGACGAGAAAAAAG
CTGTGCACCAGTCTGAACATGGATGCCACAAGTACTCAGGTGTCCTATGAAGCATTAAGT
ATACCCAAATTTCTGATCCATTTTCCTTTATTTTCTTTTTTTTTTTTCTCTCACATCTGT
GACTGTATTATGAGCAAACTGTTTACGTTGAACGGAATCGATATGTAAATTAAATCTTTT
GAAATATGTAGGACAGTGCTTGTATAGGTCTGTTAAGTAGATTATAGAATGTACGCCTTT
TTTCTGGGCGTGAAATAGATCAGAAATCCTGTTAGGTTGCCACTGGTCCATTTCAGTGTT
GCTCATCCAATCAATCATGTATTTACATGCCTGGAGTGGCCTATTCTATGTATTAACAGC
CTTTGCAAGACGCGACATTGTTCTTTCCGATATGGCTCGGAGTAGACTAAATATGCTACT
TATAGTTTTTCTTGCGTATACCATTGTCTTATAGTTTTTGCACACATTAATGTTTAAAAT
TGAAACTACGAAGCAAAACAATAAAAAAAACAAACAAAACTTAAAAATAAACAAAAGACG
CTCGAAACCAAGTGCATTTATTGAATGTTTTTGGGAATGCAAGTAGCAATACTATTGTAA
AAGTACTACTATTTCCCTGTATCATACGCTTTTACTACTATTCCTCACATAAAGCGAGAT
GCTTACAGAATGCATAAGAGAGAGAAGAAAACCCTATTACGCCCACTTGTCTATATTAGA
TTACTGTCCCTATTTATATCATCATTGCAAAACGTGAGCACCTCATTAGACGTAGATTCT
TGCATAAGTATTACTAGCAGGAGAGGAAAAACTCCACCCACACACCTCAACATGCTGAGA
ATTTTGCTGCGAGCAGCAAGAGGCAAAATCCAAATTTAAAGTAATTTACGCATAGAAGAC
ATTGTAAAGGGATTGCAAAGACGTAGAGTACGCAAGTTAGAAACCGTTCATCTTTTAAAA
CTCCCAAGTTTTGACAAATTTGCGAGTGTGTGTGTTTCTGCTGATCTTGACGAGATTAAA
CTTTGTTCCTGAAGCAACAACGACAGCAACTGAACATCCTCTGAATAAGTTAATATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved