Saccharomyces_cerevisiae Locus Poly:1:snR128
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Poly:1:snR128
Saccharomyces_cerevisiae
Poly:1:snR128
X
snR190, U14
1001..1190, 1260..1385
2385
CAAAATGCTCCAACTTCAAGCCTTCTACTTTTGGAACATCTTTACGTGGAACTCTTACC
TTACTGTAATCAATAGCTGGGATTTTAGCGGTTTCGCTGACAGAAAATACCTTGTCAAAC
TGTAATGGTGCATTATCCTTGGCAGTGCTAGCAATTTTAAGACTTTCCTTACTTTCCGAA
GGAACCAATAAAGTCATATTACTGAGGTTATCCTGTGTTAACGAGGACTCAATATCTGTA
TCGTCCATGATTTTATAATCGTGTTTATCAATTGTCATGGTTGTAGAGGATTCAAAATCT
ACAGGCAGAGATTTTAACTTGGAGATGTCCACATTTGATGGGAATTTGATCAGCCAAACC
TGTTGCTGTTTCGCTTTTTTTTTGTTATCACCGTTGAGAGGGAAATTCTTTAAATGTTTA
CATTTCTTGAAACCATCTGGTATGCTGAACTCGTTTGATATCACTTCATCATCAGAGTCT
GAATCTGATACGTAATCTTTCGAAAGCTTGGACATATCAATTTTTTGTTAATCCCGTTTA
TTGAATCCTAGCTGCTCACTGCTCACTCGATCACAGACCTATATGATACCGAATACCCTA
TAACTTGAGCTATTCAATGCTCATCGATAAAATTTTTCATTTCTTTAATTTCATGTTTGA
GAAAAAAAGTTTCGCAACACCCAATAACCACACGCTGCCCTAAGAAAAAACTTTCTCAGG
CTGAAAAGAAAATTTTTTTTCATTTTCTAGAGCTTTATGGGCAGAAACAAAATGTATAAA
TACTGGACAACCTTCTGTAAGGTTATAATAATCTCGACATTCGGTTAATAAGAATTCCCC
TACATAAGAACAAACAGCAGTGACTGTAATGTAGTAAGAATGAGAGTAATCCTCCTCTTT
CGACTTCAGCATTGCACTCCTTCCCATTTGATACATTCAAGTTTGAATAATCTCAAGAGA
AATTTCATGACACTTTTTTAAACAGAAAAGAAGAATTGATTGGCCCTGATGATAATGGTG
TCTCTTCTTTCCTCGTCCGATTCGACCATGACGACAAGGGATTTTATCTCGTTCTCTTAA
TGCGAATGATTTTGAAAAGATGTTGCTTCTGTGACATTTTTTTTTAATCATTTGTGTTTG
CAAACGGGAACTTTTCTTGCCAGTGTTATACAACACATGCAGATCTGAGCCTTTATTTTT
TCTCATGAGATTATCAAATGTGGGTAATTTGAGGAGACAGATAATATATATAATTTATGA
TCACGGTGATGAAAGACTGGTTCCTTAACATTCGCAGTTTCCACGGTAGGAGTACGCTTA
CGAACCCATCGTTAGTACTCTCGGTGACCGCTCTTCTTTAGAGACCTTCCTAGGATGTCT
GAGTGATCGTATACTGTAGTATCTTGTGTTTACTTTATCAAACCAGCTTACCAACATTGG
AATAGTTGGTTGATTTTTTTCTAGCATCCGAATGGATCTTGTATTTCCTTAATATGAAGT
AGACCAGTAATCTGAATCCTGCTAGCTTAAAAAATGCGTTGAATATATATTATTAAATAT
ATATATTTGAAGGGGAGTTGATTACATAACAGTGGCTATTCTTGCAATGGTATCAGAATT
ATTATTGTTGTTGTTGCTGTCGTTCTCCAGATTCTTGTTCGATTCCTTTGACCATCCATA
CAGATTACTCTTATAATCATAATGATAAAAGACGGGTTCAAAAATACGTTCATTATTCTC
CTCCATAACTATTGTGGGAATGTCATTCAACATCAAGAATCTCAAATGAGGAAAACTTTT
CAAAAAAGTAACGTAAATCGACTTGAAGTGATGGATAAGAGCGTGATAACACATAATAAT
ATCTCTTTTGGTCAATGATTCATGAGGAAGTTCCAGGTCAGTGGAAATTGTAGCTGCTGT
GTCATCACTACTTGGAGGAATGGCCGCATTAATTTCATCATCATCATCATCGTCATCGAT
TATTATCATTTCGGGCTCGCTCATATGAGCGGTTGATGTGGAAGTCACGGTGGAGTGTTG
ATGTGGGTTATTAACGATTTTGGGCACCAACTGGGATTTAGAATTTCTATATTCCAAAAG
GTTGCGGTTCATCTTGGTCACAAAATTAGTCAAATTCATTGGTTGTGTTCTAACGCTCGG
ATAAGCATCACAAGCTTTAGAGTATGGTAACAAAGATAGGTATTTCATCATTTTAAAAAT
ATCCTTTGCAGCAATGTCTTGAAGATCGTGAATATAGTAGTCTTCAGGGAACATGAATAT
TTTGCCCTTCAGAATGTCACTGAATACTATTTGACAGTTTGTGCAGTTGCATTGCTGATT
TAGTTGGAACTTATTTTCTTGAATATTGATGATTTGTGGGATAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved