Saccharomyces_cerevisiae Locus Mono:6:snR63
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:6:snR63
Saccharomyces_cerevisiae
Mono:6:snR63
IV
snR63
1001..1255
2255
TAAATAATACATCCACTAAACTGAAAAGGTCATTAGAAAAGCTACAAGAAGAAAGTAAC
AAAAGCATTGCAGATATGACGCATCTAGAAACTAAATTAAATGATACAGAAATAGAATTG
AAGCACTTCAAGCAGAAGGCATCTCATCTAGAATCCAAGTGTGAAAAACTACATGATACA
TTGTTCCGTGGTAACAACAAAAATAAGGGCTCGAGCGATGAAGCACTCGTAGAAGAACTA
GCAAATTTCCGTACACTTGTTTATTGTTCCCTGTGTTCTAAAAATTGGAAAAACATGGCT
ATTAAAACCTGTGGCCATGTCTTTTGTGAGAATTGCTGTAAGGAACGATTGGCAGCGAGA
ATGAGAAAATGCCCTACATGCAACAAAGCATTCAGTTCCAATGATTTATTGACAGTGCAC
TTGTAATACTAATTATTCTACCACTTTTCCACTGTTTGTGTTATATCCTCCACATACATA
TACATATAATATATGTAAATCTAGTTTTGTCATTGCTTTTATTTTATTTGCGTACATCCT
AGCCTAACTTCTGAATCAAAGAGTGACGTCTACTGTCGCATGTTTCCAAAGAAAAACTCT
AATTGTACATATCATGCTGATAATTCCTACAAGCCCTAAAGATTCATATAATACTTTGGG
CGGCCGGGTGAGAGAACGCCCGCGACCTGAAAAATTTTCTGTGATTTTTTATTATGACCT
TAATCGCGCTTGTTCAAGATATATTTTCATCACAAATGTCCATACATATATATATATATA
TATATATATATATATCAACATTTGTAACATAACTCTTCTACTGCAGTCCTTGGGGGGAAC
AAGGATAATAGCAGAATCATATCAACTGGAAAGGACAAGAATAGATTTATAAACGGGTGA
TAAGATTAATGGTATAGTGAGTTCACTCTGCCGATAGTTCTTGTCATTTCTTTAGCTTCT
TGCTGCTCTATGTTTTGCTGAAAGCGAATGAATTATGGACTTTTAATGATGAAGATTTTA
ATTTTCCGTTGGTCTATTAAGAACAGAAGTACTTCAAAACTACTTTTTAAGACCATCCTT
TTACAGTATTTTTTCAATATTGTAAAACTTCTCATTTACTTTGTGTCTTTATGATCTCAT
CGTTCTGGTGGACCATAATCAGACGCACGGTATACTTCGTTTCTGTTGGAGAATATTGGG
AGTCTTTTAATGTGATGAGTGGCCAACATAACCTTATAGTCATAGTTACACTGATTTATC
CATTTTTATCGCCTTCACTTATACGTAGACTTGCATCTTTTAAATAATTCGAAGGTAACC
CTTTGTACAAGCGTAGCAGATGATATCATTGATAAAAATTGATCTGAGTGCCCCGCTTCA
ATGAATACAGAAGTCTTGGCTTGAGTACAAGAGATTTATACAAATCGAAAATGTTTACTT
TATATTTATTAATATAAAATGAGTATTATTTTTATTTAATTGATTTAAGCATCTTCTTCG
ACAACAACAGTTTGTAGACCCTTGGCAGAAGCAACTAAGACAGGTTCAACGTAGGAGAAC
AATGGGTTCTTGGCGTCTTCTTCTTCGTTTCTCTTTCTGGAAATTCTCAATCTTAATCTG
TATTCAACACCCTTGACACCTCTCTTCCAGATAGCTTGGTTCAATTCTGGAGCTAGACGG
ACATCATCAGTACCCATGTGTAACTTGGCGAACTTCTTAATTTCCTTGACAGCTCTTGGA
GCTCTCTTCTTGAAGGAGACACCGTGCAACTATTAAAAATAAAATGGTAAATTTTTTGTT
AGTAACGATTGTTCATTTTAATATTAGTGTAATCTTGATGAATGGTTTTGTATATTGGAG
ACCCAATTTGTTCTGATTCATATTTAGTCAAACTTGGGATATGGATAATTGTCGACTTAA
AATCTAGGATTCCACTATTTAAGATAACTATTTCTGTCTTCATCGCTCTTTAAGTCCAGC
CGAAGTGTATCTTTCCCCTCTTGGATGTTATAATATTGATTATGGTCTTCAAATTCCGTA
TTATAAAATATATCTTGATCAATGATCTTTGTTGATAGGTTTCTGTGGTACAAATTCTTG
ATATTGTATTCCTTGACTATAGAAATATCTTCTTAATTAACCATTCAGATGACAAGCCCT
TGGGCATTATATTTTTATTCTTTCACATACTCTTTTGTGCAAGTTAATGGTGTATTCACG
AGTGACAACGTCTTTCAAACCGGCCATTTTTCCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved