Saccharomyces_cerevisiae Locus Mono:8:snR13
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:8:snR13
Saccharomyces_cerevisiae
Mono:8:snR13
IV
snR13
1001..1124
2124
TGATTGTATTGTCATTGTAGGAGGTACCAATTGTGCCAGTAAAAAAGAGAGGGCCCGGG
GAGCACCACATTCACGACCAATCGTGTCGATCTGCAAAAAAGGCACATGGAAAATGTAAT
TTATCAGTGTTCAACACTGAGTTGAACAGATAGCTATCTAATCAATGTTAACTTTCCAGG
GAACAAAAAGCTAAATCCACTTCTCTTTTATTTCAAAATATCATTAGAAATAGAAAAATT
TACTAACAAATTTTCGTATTATCGTAGCTGTCGTTGTTCGTGGTCGTTACGCTGGTAAGA
AGGTTGTGATCGTTAAGCCACACGATGAGGGTTCTAAATCTCATCCATTCGGTCACGCTT
TGGTTGCCGGTATTGAAAGGTACCCATCAAAGGTCACCAAGAAGCACGGTGCCAAGAAGG
TCGCTAAGAGAACTAAAATCAAGCCATTCATCAAAGTCGTCAACTACAACCACTTATTGC
CAACCAGATACACCTTGGATGTTGAAGCTTTCAAGAGCGTTGTATCTACAGAGACTTTTG
AACAACCATCCCAACGTGAAGAAGCCAAGAAGGTTGTAAAGAAGGCATTTGAAGAAAGAC
ATCAAGCTGGTAAAAACCAATGGTTCTTCTCCAAGTTGAGATTCTAAGAAGCTTTTTTCC
GAAACCTAACTTTTTTCTGTGTACTATTATTATTTTCATAATGCAGTTTATCCTTCACAT
AATTAAAAATTCATATTGTATAAACTAAAACAAACACTACCACTAAATATTTGGCCATCT
ATCTGCCATATTGGTCGTAACACAAAATGCCCAATGGAGCCTGGTAAGTTCCTTATTATT
TAACCCTAAGAACTTTATTTTGATCATTGCGTGCAAAATGATATTGTTTACAAGTTTTTT
TTTTCCAGCTTCTTTACATATAAAAGGGAAGGATTTTGAAATTATAAATGGCATCTCAAA
TCGTCTCTATATCTTTTGTTAATTGGATTTTTTAAAGGGTCAGGAAGTTTTTTCCTTTTT
ATATGATGAATATGAGTGCATTTGGCTCGAGTTGCTGTTTGGCTTTTGCCAAATCAGTAA
CGGTGTGGAAAAACTCAAGCTACCTTTTTTTACTTTTATCTGACCTTTTAACTTCCCCGT
AGAAAATCTTAGTAATCCTTCTTACATTGTATCGTAGCGCTGCATATATAATGCGTAAAA
TTTTCTCTTTTTAAAAGATGTTAGTACGTTGGGTTTGGCTTGTTCATTTTTATTATCCTT
TATTTACTTGTAAAAAAACGAAAGTGACGAAGTTCATGCTAAGATTGAAGAAAATTATTT
ATCGTATACTTTGCAGGACAAGAGACACGGAAGCGACAGAAAGACAGGGAGTACTATCAC
CATCCATAATACTGGAGTAACATTATGTCTCAAAGAATAATTCAACCAAGCGCATCTGAC
CAACAATTCCCAGGTAAATCTGATGGATATGAATATACTGTTGGGCCTAAGCAAGCGATA
ACAAGCGAAGCTTCAACAACATACATTCCCTCTAGAATATACTCAGAGTCTCTACTTTTC
AAAAGGCAAGAAGCGTCTTTATCAGCAATGGCTTTCTTGTTCCAGGAAATGATTTCACAG
TTGCATAGAACATGTAAAACTGCAGGCGATTTTGAAACTAAATTAAGTGACTATGGCCAC
AATATTGGAATTCGTCTATTAGAACTGCTGAATTTTAGGGCTTCTGTATCTCCTAGTTCT
CTTCCCAGAGCATCTGCTTTCCTTTCACAAAATGAATCTTCTTCAAAGTTATCAAATGCG
TCAAATTCCCCGGGCATGTTGGCTAACTCCAGCACAGCGACTTCTGCATCTGCCAATGAA
CGACTCCAAGAAAAGCAAACAGAATCATTGTCTAACTACATTACAAAGATGAGGCGCCGT
GATCTGAAAATTCTCGATATACTGCAGTTTATCCACGGTACCCTATGGTCATATCTTTTT
AATCACGTAAGTGATGATTTGGTTAAATCTTCAGAACGTGACAATGAATATATGATAGTA
GATAACTTCCCCACTTTAACCCAATTTATCCCAGGTGAGAACGTTTCTTGTGAGTACTTC
GTTTGCGGCATTATCAAAGGATTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved