Saccharomyces_cerevisiae Locus Mono:13:snR52
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:13:snR52
Saccharomyces_cerevisiae
Mono:13:snR52
V
snR52
1001..1092
2092
ATCCCCATGCAGCCTGTCAAAGACTGATATATGCAGTCAAGAAATAAAAAACAAATTGC
AATAAGCTCTCCACTATAGATGGCACAAAAACAGGTTAATAACAAGTAGTTATTACATTC
CTCAACGAGATGAGCCAACAAGCAACCAATAGTGCACCTACTTGTCTAACTTTAATTGAG
GTTGTGCTCACAAGAAATGTTTTGCCAGGTATCTACCTCAATTGAATAACAACCGCAAAA
GCTTTAGTACTAAATTGTCTCTCACCTTGTCTTCAAGAAAAGGGGAAGGTAGATGAGAGA
GAAGTCTTGCAATTTTTCTCAACCTTTCAACTCGAATGGAAATCAGGTTGTAAGGGAAGC
AATGAAATGTCAGCAAACAGCCACTGACTGTAATTCTTTTGTTGGAGTAAAAATCAACTA
TCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGTGTTAGAAGATGA
CGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAAT
GTAATAGGATCAATGAATATTAACATATAAAATGATGATAATAATATTTATAGAATTGTG
TAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTCGAGGAGAACTTCTAGTACTTT
CTACATACCTAATATTATTGCCTTATTAAAAATGGAATCCCAACAATTATCTCAAAATTC
ACCCACTCTTCATCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAG
AAACTTGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTACAAC
TCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCATTTTTTCACACCCTA
CAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGCATGT
TTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCTACTATGATGAATGACATT
AGCGTGAACAATCTCTGATACAAAATCGAAAGATTTTAGGATTAGAAAAACTTATGTTGC
CTTCCTTCTGAAATTTATTTTTTGTCACTATTGTTATGTAAAATGCCACCTCTGACAGTA
TGGAACGCAAACTTCTGTCTAGTGGATAACAGAATTTTTCTATGGCCAATTTATTCTTTT
TTTTTTCCCTTTTCTTAATGTGCGTATCATTGCCGGGTTTGAAATTTCGAAATTAACTAC
TAAAAATTACCGCTTTAATGTATGGAATATGTGTATCTTGCTAGTTTTGCGTTGCCCTCG
CGATATCCCTATACGCCCACAGTGCAAACACAGTAGAGCTTTGTGATAATACTCGCAAGG
AATACAGTACATCAAAAACTTATTACACAGGCTTTCCAGTGCACTCACACCCACTTTACT
GTTTTTTCTGCTTTTTTTCTGCTTTTTTTTCTTTTTCTTTTTTTCATCTTACTTACTTGA
GCCTAGATAATAGAAGATAGTAAGTTTGGCAGAGCCCAGTCACAAATACAGATTAACCTC
TAACAAAGTCCACATCGACACCGTTTCCAACTTGATATCATAAACTTTGGATATTGTATT
AAAGTTACCAGTATCACTTTTAACAAATTTTTTTTTTTTTTTGGCTATGCTCATCGTTGC
CTGAGTATTCTTTAGTCATTTCCAGTTTCTTCAATAACAAAAAACATTAGTACGCGTTTC
TATAATTAGGTGAAAGCATAAAGTTTTTAAAAATGACCGTATTACAACCACCATCTAGTG
TTTGTTATCCGCTCAACCTCCCTATTGTACCGAATCCCAATCTGGATGAAGCAACAAGGA
AGAAGCTCACTTTGGAATGCAGAACTGGAGCTGCAGTAGAACTAGCCCGTTCAGGTGTTT
TTGTCCATGGTGGGCTCACACTACCTTTAAATCTGACTATTATAAATTCATTACAACTGC
AAAAGGAGCTAATTCTATATTTTGGTAAACAGAAGGATAGAAATGCTGATTTTAAAACAT
TAGCTGATTGGATAAGCCCTGAGATATTTTTCCTTGATTTAATTTCCAGAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved