Saccharomyces_cerevisiae Locus Mono:45:snR17b
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:45:snR17b
Saccharomyces_cerevisiae
Mono:45:snR17b
XVI
U3b
1001..1014,1145..1462
2462
GAATGCCATAATTTAGAGCTTTTAACAGTCAAATTGGATATCGATGGTAAATGTGATCT
CGTAAATTTCGATACTGCAAATTATTTTATAAGTTACCCAGAAACGATAGTAGACTCTTT
TATTATAAAGATAAAACTTAGATATAGTTCTGGTATACTTGATTTGTTCTACTTGGACCC
TTTAGCTGTCTGGTGTTAAATCTGAGTTTTGCATTCATCTTACACTTTCTATATTCTTGC
ACATTTTAGTCACCACGTATATGATCTGGTAGCTTTTCTGAAGTCGCTTTTTCCTTTATT
ATCAACGTTTCACTTGAAAATTCCAAATTACTAGCACAAAATATTTTTAATGTCTTCTCG
TCATCAGTTTTAACATACATCTATGGGATTCAGCCATTTTTCAATTTATTTGATTGTTGG
TTTCTTACGGATTCTTACAATTGCTCAAGGCAAAATAACTCAAGTTTTGAACTAGTGATT
AATACACGTAAATTAAAGCTTGATAGCGAATATTTTGCCAAACGGGAGGCAAAGGTATCA
TGCCGGTGAAGAGTAGAAGGGAGGGACAGGATACGAGTTTAGGCCGGAAAAGATGAATCA
GCTCTGTCTAACGACTGTACTGCTAGAGGGAAGCTGAGTATGACCTCCGTACGTTCCATT
GAGCGGAGAATTCTTCGACGGGCACCCAAGGTGTGTACGCGAAACAAACTGAGAGAAGAA
AAAAAAAAGTAATCAAAGGAAGTGTAAGGGTGTAAAGAGGTAAGGATGTTAATATTGCCG
TGGAAAAAATTGCAACGAGAGGTGGGTAACTACTACGATATGTATTTCGAGCATTTTTCT
TAGGGCTGAATTTTTCATTAGTTTTTCCATTCTCGATGAGGTGAATGAGTAAAGTTAAAG
AAACATATAAATAGTGAGCTCTTTCCAAACAACTTGATAACTTCACTCATTCATCCTTTT
CTTAGTTTTATTCTCTTCTTGTTCTTTTTACTAAAAAAATTGTCGACGTACTTCAGTATG
TTTTATACCATATACTTTATTAGGAATATAACAAAGCATACCCAATAATTAGGCAATGCG
ATTGTCGTATTCAACAACCATCTTCTATTTCACCAGCTTCAGGTTTTGACTAACACATTC
AACAGTAGGATCATTTCTATAGGAATCGTCACTCTTTGACTCTTCAAAAGAGCCACTGAA
TCCAACTTGGTTGATGAGCCCCATAACCTTTGTACCCCAGAGTGAGGAAATGAAATCGAA
TTTAAATTAGCTTGGTCCGCAATCCTTAGCGGTTCGGCCATCTATAATTTTGAATAAAAT
TTTGCTTTGCCGTTGCAATTGTGATAACTTCCTTTGGAATTTGTTGCGATATTTAATGGC
GCGATGATCTTGACCCATCCTATGTGCTTCCATTTTGGAAGGATAGGGATTCATGGGTGG
GTACAAATGGCAGTCTGACAAGTCAATCAAATCATTTATTTTTTCCAAAATATTTTCGAA
TCAAAGGTTTGATTCAGTATTTTGGAGCCGCATTATACTTAGTATTTTAATTAAATTACA
TTACAATCATGAATGTCTAAAGAACTCTTACTTTACTCACCGAGTTCAGTTTTCAAGAGA
TCGAGACACTTCTTTAAGATATATAAATGGTTTGCTACTAGCATAGAGGGATCTTCACTA
GGCAGCGATGACCACGTTACATAACACGGCCTATTGAACCTTTCAGATATTATTGTGGCC
ATGTGTCTAGCCATATCACGAATCCGGTCATCTTTAGTATCTAATAACGGTATCCCCACA
ACGTTGCTTCCGCCTGATTTGAGGTTAATATGTCTATCCCTCATTAAGGGAATGGCGTAG
TAATAACATGATAAGGATGAAGATGAATTCAGCGAGGCCTCTTGTTTAAATCCCACTACC
AGACTAATAGGTATTTTTTTAGAACGATCGTCTGCAGGTAGAGTAGCAATAACATCCAGC
GTCGGCTGTAGAAATCCAGATTCTGATTCAATAGTTCGGCTAATCGTCTTTACTAACATC
ACAATCACTCGCGTCTAATCTCAACGGAAGCATCTTTTGCAATTTCCCGGTCCAAATCAT
TTGTAAAACATAAACAATATACCAGAACCTAATCTTTTAATGTACTTTCATGTCAACAGT
AAATTTTCAATCCGGGCAACGAAAACTTTCGTGCAAATAATTTCCGGAGCTCCTAAACGA
ACTAAAATAAGCTCTTTCCCGTATGTACCTCATCTTGTTACAGCACGAAGAATAATCGCA
CCGACCATTGTGTCAATCACTTCACGGGACCAGTAACTCATTCCGTTCGCGTTTTACTAG
CTGCAGCATTTTTGGGCCCTCTCACGTAAGTCATTATCTTTCGGAATTGTGAGGTGCACG
GATGCGGACTTCTCCTTTTGCCATTGCGTTCGTTGATTATTCTTGTTTTCCAACCTTTGC
CCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved