Saccharomyces_cerevisiae Locus Mono:1:snR161
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:1:snR161
Saccharomyces_cerevisiae
Mono:1:snR161
II
snR161
1001..1161
2161
AAATCTACTGAAAAAACGGAAAAAACTAGAATAAACCATTTCTATATATACTCATGTTC
CCTGACGTTCTTTTTCCTTTTTCTTTTTCCAGAGTTAACGATAAGATAGACATAAAGTGA
CAGCGCTTAGCACCGTCTGTTTGCAAATCTAACTTAAACTCCTTTTTTTCTGTCACCTTA
AACAGTGTCAGAAAAAATACTAGGTATAAGAAAACGAGAAAAAAATAAACAGCGAACTCG
TGCAAACTTTGCTAATAAACAATTAGCTGTAACATTTGTGTGTGGGTGTGGTGATGGTAG
GCTTCCCATGGTAATTAAAAGGTTAGGTCGAGAAGAGGATCGGTACGAAGAAGGAATAAC
AGGAATAAGTTCAAAAACACTGCTTTAGCAACTAAATGCAATAGCAGTGTTTAAGAATTT
ACGGTTTGCATTTTCTAAACTCAGATTTTAGCCATCTATAAGTAGAAACACAATAAAAAA
CCACAAATTGCGCACACACAAGCATCTACACTGACACCAGCATACTCGAAATTCTTTGGA
AAAGAAAAGAGCAGCAGGCTATCAACTGAAAGATCAATCCGAAATCCGACACTATCTCTT
CACCATCGAGTGCCTACCAAATTTCTGAGGCCTGCATGATGGAAAACTCAAACGTAGAAT
GTACAAAAAACACGGACTGAAAAAAAAAAAAATACGATTAAGCAAACGCAACAGCCATTG
ACATTTTCATAGGGTACCTATCTTCCTCTCTAGTTTTATTCTCAAACCAGAAAAATCACA
CTAAAAGCTACAAAGAAGGTCTTTTAATTGAGAACCTTGAGATCTATATGTCACCATTGC
TAAAGAGGAAGTTTTTTCGCGAGTTCGCGCGCTGAAAACTTTTCTCCCATTTCCTTTTTT
TTTTATTTTTTTGGCGTTTAGATATAAAAGCTTTAGCAGGATTGCTCTTCCTTTTCACCA
CACATATAGTGATATAAAATTTATTTATAAACTAACACAAGTAAATATACAACACCCAGT
ATTTTTGGCTGCCCGTGTCTTTCTCTACCACGGGTAGTCTCTCTAAGCTGGCAGATAGAT
GTTTATTGAACCGCTTAAGTTCCGTTGTGAAGTTTTCGTCTTTCAGGCTGTATTTCATAA
CACTACTGTAGTTCACACATACACATGCGTAATGCCCCAATCTTGATAAACAGCACATAC
AAGTAACAGCAAGTCTGCTTAGCAGCCAGATAGAGCTCTTATAGATGCCACCAGAACCAG
CGCCGGGTAAATTGTAAATACTAGAAGGGGCCGCAACTTATAAGAAAGAAGAAATGACTA
ATTTGCATGATTAGATATTTTAAAGATACTCTACCTAGACCAGTAGTACACTTCACGGAT
CTGCACTGAAAATGACTAAACAAGCTGAGGAGACCCAAAAGCCAATCATATTTGCTCCTG
AGACGTATCAATATGATAAATTTACTTTGAATGAAAAACAACTTACTGACGACCCAATCG
ATCTTTTCACCAAATGGTTCAACGAAGCCAAGGAAGACCCAAGGGAAACGTTGCCAGAAG
CAATTACTTTTTCATCCGCGGAACTACCTAGTGGGAGGGTGTCGTCCAGGATTCTTCTTT
TTAAGGAGCTCGACCATAGAGGTTTTACTATTTATTCTAACTGGGGAACCTCTAGAAAGG
CTCATGATATTGCTACCAACCCGAATGCGGCAATCGTATTCTTTTGGAAGGATCTGCAAA
GGCAGGTGAGAGTTGAAGGTATCACAGAGCATGTTAACAGAGAAACTTCTGAAAGATACT
TTAAGACGAGACCTCGTGGATCCAAGATCGGTGCATGGGCTTCCCGCCAATCGGATGTTA
TCAAGAACAGAGAAGAACTAGACGAGTTGACCCAAAAAAACACCGAACGTTTCAAGGATG
CTGAAGACATCCCATGTCCAGATTATTGGGGTGGCTTGAGAATCGTTCCACTGGAAATTG
AGTTCTGGCAAGGTAGACCCTCGAGATTGCATGATAGATTCGTTTACAGAAGAAAAACAG
AAAACGATCCATGGAAAGTCGTTAGACTAGCCCCATGAGGGACTGTTAATGAAAAATTCA
ATGTAGGATCTATTTAACACCATATAATTCTCTCATTTTCTATTTTATACTGTATAATGA
AT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved