Saccharomyces_cerevisiae Locus Mono:33:snR11
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:33:snR11
Saccharomyces_cerevisiae
Mono:33:snR11
XIII
snR11
1001..1258
2258
AAAACAAGAATATTATATAATTTTGAGTGATTAATGACCAATGGAAATAGCCAGAGGAA
AAATACCATTTAATATGCATACACAGGCTTATCTCTTCACTCCTATCTAAAAAACTATTG
TGTTTGAAGATGAGGTCCATTTTACAAAAAGAATAGTATTGCGAAAACGCCTTCAAATGG
AACATTTTAGTAGTTGCACCATTGTAAGAATTGCCATGGAAAACAATCACAAAAAGATGC
TATACAAAGCCGTACATTATACGTCACTTCCCGCCGACACATATACACGTGTATATGTAT
GCCTATTTCACATGTTACTAACTGAAGACAACCTGTGTCCTTATATTTAGGAATTGCTAT
TGGTTTAAACAAAGGTAAGAAGGTCACTAGCATGACCCCAGCTCCAAAAATCTCTTACAA
GAAAGGTGCTGCTTCCAACAGAACCAAGTTCGTAAGATCTTTGGTCAGAGAAATCGCTGG
TTTGTCTCCATACGAAAGAAGATTGATTGATCTAATAAGAAACTCTGGTGAAAAGAGAGC
TAGAAAGGTCGCCAAGAAGAGATTGGGTTCTTTCACCAGAGCCAAGGCTAAGGTCGAAGA
AATGAACAACATCATTGCTGCTTCTCGTCGTCACTAAGTTTCTAAAAACTGATTTTTGTA
ATATATATATAGATATCATATTTTCTTTTTAACTTAGGAAAAAATAACACCAAAAAAAAA
ACCACCAATACTTTCACACATGAGAGGGCCTAGAGTAAAGTACCACTAGCCATGCAAAAA
GCCCATGTACTGAGCTGATAGTCGTTACCAACCCTACATTTTTTTTCTGAAGCAATATAA
GTGTTACCCGAAAAGTATGAATATTATTTTTTCTTCGTACCGTTATATCTTTTTCTGGTA
TATAAAGCGGTGAGTTTAGAAGAAGTTCCTGTGGTGCAAGAATCTTTATTGGTATTTAAA
AAATCTTTTCTTTTCCTTTTTTTGGTTTTTTGAAAAAGGGTAATAATGTCTTTTATAATA
GACACCCAGAGTCACGATTCGTCTTGGTTTTAGAGATTCTGTTTCGACAGTTTTTTTAGG
CGGTGGACGTATATAGTTTACTTAATCGTTTACTATACGGTGGAGTACTAATACTATTTC
ACTGTCGTGCTCGCGGTTGATCTTAGATAAATATATTTCTTTTTCATAAAGAAAGTGAGT
GGATCTTCCCTGGAAGTACGAATAATGTACTTATGATTAGATTCTCTTCACGCACATACC
TTTTTTTTTTTTTCAATTGCTAGTTCATACATACGTAGAAAGAAGGGCCAATTGGAAGCC
TCAACTGTCCCCTGGTGTAAGCTTTCGCTGTTTCATCTTCAACTCAAGAAGCGAAGGTAG
CGGACAGCAGGGTGACCGTGAATCTTTTCCATTGTCATTGTAAAATTTTGAGCAGCAGAT
GTACAGCTGATCTATAACTTTAGCGCATTTAGCATCATCGTACTGATGTGATAGAAGGCA
ATCTAAAATTAATGTGAAAAAACGTTAGTGAAAAGAAAAAAACGATCGAATCTTTTGAAG
TTAATATTACAAACCTTGGATGGCGCAGGCCTCCTTCTGGCATGGATTAGACATATTTAC
CTCTTATTTGAACAAATCTCAACAACTAAAAAAACGCTCAATATCTTGGAAAAAAAGAAC
AGTAATATTCTGTCTCTCCACACCCTCTTCTGAACTCTCATATACACCCCATGGGTGAAA
AGTAATATCCGTAAAAGTCTCGCTAACGGATGACGTTAACAACGCACGCCCGCTCCTTGC
GAAATTTATTGTGGGGACGTCGTTCACGTGCAAAAGTCGCCAAATATTAGCGACGGGCAA
CATCGGAAAAACTCTGCGCCCGCGATTCCGATTGAGATGTGTAATTTGTAGTATTGAACG
TGACAGGAAACAAAAAATATCAAAACGCTAGCAAGGTTTAAGGGGAGGGGTGAAGAACGA
ACGATAGGATACTGCACAAATCAGCAATTAAGAAACAATATACAAAAACCCCCAAAGTGG
TCATGTTAAGGAGGGCATTTTTCCGCATGGAAACGAAACGTGGGCATGACGTGGAAGCGA
TGATCCGAGCGCTTCTGCTACTGTGGTGACCACCGTACCAAAGGAGGGGTAATAAGACCC
TGTGCCCTTTGCCAGCATACGTGTTACCCCCCTCAAAAAGAGCTGGCTGTTCGAGCTAGC
TGCTCTTTCTGTTGCCATTCCCGTACCAAGAGCGCCCCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved